ID: 1175241483

View in Genome Browser
Species Human (GRCh38)
Location 20:57552706-57552728
Sequence TTATACAAGTTTTCTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241483_1175241492 22 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241483_1175241490 9 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG No data
1175241483_1175241491 12 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241491 20:57552741-57552763 TTTGGCAGAAAATTGGAAGGTGG No data
1175241483_1175241486 -6 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data
1175241483_1175241488 5 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241488 20:57552734-57552756 GCCGGCTTTTGGCAGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241483 Original CRISPR TTATACAAGTTTTCTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr