ID: 1175241486

View in Genome Browser
Species Human (GRCh38)
Location 20:57552723-57552745
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241483_1175241486 -6 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data
1175241482_1175241486 -1 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data
1175241478_1175241486 24 Left 1175241478 20:57552676-57552698 CCTCTTGCATCATTGCTTCCTTG No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data
1175241481_1175241486 6 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241486 Original CRISPR GTATAACCTAGGCCGGCTTT TGG Intergenic
No off target data available for this crispr