ID: 1175241487

View in Genome Browser
Species Human (GRCh38)
Location 20:57552729-57552751
Sequence TTTCTGCCAAAAGCCGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241487_1175241492 -1 Left 1175241487 20:57552729-57552751 CCTAGGCCGGCTTTTGGCAGAAA No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241487_1175241494 22 Left 1175241487 20:57552729-57552751 CCTAGGCCGGCTTTTGGCAGAAA No data
Right 1175241494 20:57552774-57552796 AAATGAAAGTTAAAGAATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241487 Original CRISPR TTTCTGCCAAAAGCCGGCCT AGG (reversed) Intergenic