ID: 1175241489

View in Genome Browser
Species Human (GRCh38)
Location 20:57552735-57552757
Sequence TCCAATTTTCTGCCAAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241489_1175241492 -7 Left 1175241489 20:57552735-57552757 CCGGCTTTTGGCAGAAAATTGGA No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241489_1175241494 16 Left 1175241489 20:57552735-57552757 CCGGCTTTTGGCAGAAAATTGGA No data
Right 1175241494 20:57552774-57552796 AAATGAAAGTTAAAGAATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241489 Original CRISPR TCCAATTTTCTGCCAAAAGC CGG (reversed) Intergenic