ID: 1175241492

View in Genome Browser
Species Human (GRCh38)
Location 20:57552751-57552773
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241487_1175241492 -1 Left 1175241487 20:57552729-57552751 CCTAGGCCGGCTTTTGGCAGAAA No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241482_1175241492 27 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241483_1175241492 22 Left 1175241483 20:57552706-57552728 CCAGGGAAAGAAAACTTGTATAA No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241489_1175241492 -7 Left 1175241489 20:57552735-57552757 CCGGCTTTTGGCAGAAAATTGGA No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241492 Original CRISPR AATTGGAAGGTGGAAAGCCA TGG Intergenic
No off target data available for this crispr