ID: 1175245794

View in Genome Browser
Species Human (GRCh38)
Location 20:57581250-57581272
Sequence CCGGGCTGCCGCGTGTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175245784_1175245794 -4 Left 1175245784 20:57581231-57581253 CCACGATCTGCCCTCCCCACCGG No data
Right 1175245794 20:57581250-57581272 CCGGGCTGCCGCGTGTTCCTGGG No data
1175245783_1175245794 -3 Left 1175245783 20:57581230-57581252 CCCACGATCTGCCCTCCCCACCG No data
Right 1175245794 20:57581250-57581272 CCGGGCTGCCGCGTGTTCCTGGG No data
1175245781_1175245794 4 Left 1175245781 20:57581223-57581245 CCGAGTCCCCACGATCTGCCCTC No data
Right 1175245794 20:57581250-57581272 CCGGGCTGCCGCGTGTTCCTGGG No data
1175245782_1175245794 -2 Left 1175245782 20:57581229-57581251 CCCCACGATCTGCCCTCCCCACC No data
Right 1175245794 20:57581250-57581272 CCGGGCTGCCGCGTGTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175245794 Original CRISPR CCGGGCTGCCGCGTGTTCCT GGG Intergenic