ID: 1175246336

View in Genome Browser
Species Human (GRCh38)
Location 20:57584455-57584477
Sequence GTGTGGGTCTGAGGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175246330_1175246336 -8 Left 1175246330 20:57584440-57584462 CCCCTGGAGTGACAGGTGTGGGT No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data
1175246332_1175246336 -10 Left 1175246332 20:57584442-57584464 CCTGGAGTGACAGGTGTGGGTCT No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data
1175246322_1175246336 23 Left 1175246322 20:57584409-57584431 CCCAACTCCCAAGGTCAGGGGAT No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data
1175246325_1175246336 15 Left 1175246325 20:57584417-57584439 CCAAGGTCAGGGGATCACTCATG No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data
1175246323_1175246336 22 Left 1175246323 20:57584410-57584432 CCAACTCCCAAGGTCAGGGGATC No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data
1175246331_1175246336 -9 Left 1175246331 20:57584441-57584463 CCCTGGAGTGACAGGTGTGGGTC No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data
1175246324_1175246336 16 Left 1175246324 20:57584416-57584438 CCCAAGGTCAGGGGATCACTCAT No data
Right 1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175246336 Original CRISPR GTGTGGGTCTGAGGGTCAGA GGG Intergenic
No off target data available for this crispr