ID: 1175247766

View in Genome Browser
Species Human (GRCh38)
Location 20:57591873-57591895
Sequence GCTGCTGGGGCGCCGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175247750_1175247766 19 Left 1175247750 20:57591831-57591853 CCCAAGAGAAGACGTGGGGAGCA No data
Right 1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG No data
1175247751_1175247766 18 Left 1175247751 20:57591832-57591854 CCAAGAGAAGACGTGGGGAGCAG No data
Right 1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG No data
1175247746_1175247766 26 Left 1175247746 20:57591824-57591846 CCTGGGTCCCAAGAGAAGACGTG No data
Right 1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175247766 Original CRISPR GCTGCTGGGGCGCCGGGAGG GGG Intergenic
No off target data available for this crispr