ID: 1175248326

View in Genome Browser
Species Human (GRCh38)
Location 20:57594418-57594440
Sequence TCCTGCCCTGCGAATTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175248318_1175248326 -7 Left 1175248318 20:57594402-57594424 CCTTGCCCCCGCGCCCTCCTGCC No data
Right 1175248326 20:57594418-57594440 TCCTGCCCTGCGAATTCTGTGGG No data
1175248317_1175248326 17 Left 1175248317 20:57594378-57594400 CCGAATTGAGGCAGAGGGCGGCA No data
Right 1175248326 20:57594418-57594440 TCCTGCCCTGCGAATTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175248326 Original CRISPR TCCTGCCCTGCGAATTCTGT GGG Intergenic
No off target data available for this crispr