ID: 1175249883

View in Genome Browser
Species Human (GRCh38)
Location 20:57602858-57602880
Sequence AAGTTCCCGTAGAAGGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175249883_1175249897 24 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249897 20:57602905-57602927 TGGTAAATAACAAGCTGACATGG No data
1175249883_1175249889 -6 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249889 20:57602875-57602897 GAACTTAGCCCCTAGCGGGGTGG No data
1175249883_1175249892 -1 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249892 20:57602880-57602902 TAGCCCCTAGCGGGGTGGTGGGG No data
1175249883_1175249890 -3 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249890 20:57602878-57602900 CTTAGCCCCTAGCGGGGTGGTGG No data
1175249883_1175249891 -2 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249891 20:57602879-57602901 TTAGCCCCTAGCGGGGTGGTGGG No data
1175249883_1175249887 -10 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249887 20:57602871-57602893 ACGGGAACTTAGCCCCTAGCGGG No data
1175249883_1175249888 -9 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249888 20:57602872-57602894 CGGGAACTTAGCCCCTAGCGGGG No data
1175249883_1175249896 4 Left 1175249883 20:57602858-57602880 CCATAGCCCTTCTACGGGAACTT No data
Right 1175249896 20:57602885-57602907 CCTAGCGGGGTGGTGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175249883 Original CRISPR AAGTTCCCGTAGAAGGGCTA TGG (reversed) Intergenic
No off target data available for this crispr