ID: 1175254913

View in Genome Browser
Species Human (GRCh38)
Location 20:57636128-57636150
Sequence AGGGAGAAGAAAAATGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175254910_1175254913 6 Left 1175254910 20:57636099-57636121 CCTGCTTTGCAAGAAATATTAAG No data
Right 1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG No data
1175254909_1175254913 14 Left 1175254909 20:57636091-57636113 CCAATAGACCTGCTTTGCAAGAA No data
Right 1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175254913 Original CRISPR AGGGAGAAGAAAAATGATGT AGG Intergenic
No off target data available for this crispr