ID: 1175256313

View in Genome Browser
Species Human (GRCh38)
Location 20:57649670-57649692
Sequence GTACAAACCTTGGCAAAAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175256306_1175256313 30 Left 1175256306 20:57649617-57649639 CCATGCACACACACAAGGTCCAC 0: 1
1: 1
2: 2
3: 20
4: 237
Right 1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 168
1175256308_1175256313 11 Left 1175256308 20:57649636-57649658 CCACTTCTAGGTTTTCAGCCTAG 0: 1
1: 0
2: 3
3: 17
4: 302
Right 1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 168
1175256311_1175256313 -7 Left 1175256311 20:57649654-57649676 CCTAGATGGGAGTCGTGTACAAA 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175256313 Original CRISPR GTACAAACCTTGGCAAAAAA AGG Exonic
904921774 1:34013682-34013704 GTCCACACCTGGGGAAAAAAAGG + Intronic
905785279 1:40751025-40751047 GTACAAACCTAGGAATGAAATGG - Intronic
907400634 1:54222910-54222932 GAACAACCCCTGGCATAAAAGGG + Intronic
908198002 1:61764629-61764651 TTACAAAATTTGGGAAAAAATGG + Intronic
908580034 1:65505450-65505472 GTACAAACAAGGTCAAAAAACGG - Intronic
911470555 1:98312992-98313014 GTTCAACCCTGGGCACAAAAGGG + Intergenic
911971164 1:104439703-104439725 GCACAAATCTTGGGAAAAATGGG - Intergenic
913996138 1:143653141-143653163 GTGCAAACCCTGGCAAAGGAGGG - Intergenic
915761048 1:158313464-158313486 GTACAAATATTAGCCAAAAATGG - Intergenic
918546587 1:185691392-185691414 GAACAAACCTTTGGAAAAATAGG - Intergenic
918771202 1:188562606-188562628 GAACAAATCTTGGCACAAATAGG + Intergenic
920144762 1:203849999-203850021 GCACAGACCTTGGAAAAAAGGGG + Exonic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
921820382 1:219610129-219610151 GCACAGACCTTGGAAAAAAGGGG - Intergenic
923056931 1:230433656-230433678 TTTCAAACCCTGGGAAAAAAAGG - Intergenic
924643261 1:245853700-245853722 TTCCAAACCTTCTCAAAAAAAGG + Intronic
1064031590 10:11886363-11886385 TTTCAAACCTTGGCTAAACAAGG + Intergenic
1069359019 10:67621018-67621040 GTCCAAAGCTTGCCATAAAATGG - Intronic
1070471106 10:76780305-76780327 GTATAAACCCTAGAAAAAAATGG - Intergenic
1075140055 10:119824867-119824889 ATACAATCTTTGGCAATAAAAGG - Intronic
1076591626 10:131587479-131587501 GAAGAAACCTTGGCAAGGAAAGG - Intergenic
1080143348 11:28949065-28949087 GTAGAAAACCTGGCAAATAAAGG + Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1085089610 11:73699481-73699503 AGACCAGCCTTGGCAAAAAAGGG - Intronic
1090132899 11:124163468-124163490 GTTCAAAGCTTTGCAAAGAAGGG - Intergenic
1091363138 11:134994035-134994057 GTACACACAGTGACAAAAAAAGG + Intergenic
1092582114 12:9853134-9853156 CTTCAAAGATTGGCAAAAAATGG - Exonic
1093009215 12:14086858-14086880 GTACAAACATTAACACAAAATGG - Intergenic
1093943079 12:25076508-25076530 CTGCAAACCTTTTCAAAAAAAGG - Intronic
1094386660 12:29901853-29901875 GTAGAAAGCTTGGGTAAAAAAGG + Intergenic
1101192219 12:102346812-102346834 GTATAAAACTTGCCAAAGAAGGG + Intergenic
1107305233 13:39011976-39011998 ATCCCAACATTGGCAAAAAATGG - Intronic
1109867340 13:68282484-68282506 GGACTAGCCTGGGCAAAAAAGGG + Intergenic
1111171784 13:84535924-84535946 TGACAAATCTTGGCAAAAGAAGG - Intergenic
1112613511 13:100979552-100979574 GTAGAAACATTGACAAAAATGGG + Intergenic
1115573500 14:34689164-34689186 GTATAATCCTTGGCCAATAATGG - Intergenic
1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG + Intergenic
1117692963 14:58327476-58327498 GTACATATCTTGGTTAAAAAAGG + Intronic
1118369826 14:65128376-65128398 GTACAAAGATTGACAAAAATGGG - Intergenic
1120313382 14:82860227-82860249 CTGCAAACCCTGGCAAATAAAGG - Intergenic
1120905245 14:89614827-89614849 GTGCAAACCATTGCAAGAAATGG + Intronic
1121997981 14:98620114-98620136 CCACAAACCTTGGCCAAAAATGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123738773 15:23212979-23213001 GTACAAACGTTGGAAAGCAATGG - Intergenic
1124289983 15:28441613-28441635 GTACAAACGTTGGAAAGCAATGG - Intergenic
1124293246 15:28475676-28475698 GTACAAACGTTGGAAAGCAATGG + Intergenic
1126696858 15:51333676-51333698 GTGCAAGTCTTGGCAATAAAAGG + Intronic
1128923716 15:71634961-71634983 GTGCAAACAATGGCAAACAATGG - Intronic
1135690339 16:24532136-24532158 GTACCAGCCTGGGCAACAAAAGG + Intergenic
1137362277 16:47829550-47829572 GCACAAATCTTGGCAATACAAGG + Intergenic
1141449890 16:84091724-84091746 CCACAAACCTTGTCAACAAACGG + Exonic
1145353528 17:22113179-22113201 CTACAAGCCTAGTCAAAAAAAGG - Intergenic
1151084334 17:71363623-71363645 GTACAAACTGTGCCAAGAAAAGG - Intergenic
1153724207 18:7938468-7938490 GTTCAAACCTTTGCAAAACTAGG - Intronic
1155594322 18:27467153-27467175 GGAAAAATCTTGGGAAAAAAAGG + Intergenic
1156526506 18:37772941-37772963 GTAAAATCCTTGCTAAAAAATGG + Intergenic
1157035510 18:43968355-43968377 TTACAAACCTTGGAAAGAAATGG - Intergenic
1157854009 18:51087314-51087336 ATGCAAACCTTAGGAAAAAAAGG + Intergenic
1158335206 18:56408791-56408813 AAATAAACTTTGGCAAAAAATGG + Intergenic
1161536563 19:4822809-4822831 TTACAAACATTGGCATCAAATGG - Intronic
1164102627 19:22071100-22071122 GTAGAAACCTTTGCACTAAAGGG + Intronic
1164317869 19:24110360-24110382 ATACAAGCCTGGGCAAAATATGG + Intronic
1164842709 19:31405449-31405471 TTCCCAACATTGGCAAAAAAAGG - Intergenic
1168598741 19:57700980-57701002 GTACAAACCAAGGCAATAAGAGG + Exonic
927979887 2:27368456-27368478 GTAGGAACCTTGACAAAACAAGG + Exonic
929285630 2:40132282-40132304 CTACAAACTTTGGCTAAATATGG + Intronic
930307051 2:49687649-49687671 ATACATACCCTGGCAAAGAAGGG - Intergenic
930497804 2:52171153-52171175 GAATAAAGCTTGGAAAAAAATGG + Intergenic
930828695 2:55719812-55719834 GTACAAAGCTTTGCAAGAAAGGG - Intergenic
931147830 2:59539311-59539333 AGACAAAACTTGACAAAAAAAGG - Intergenic
931478803 2:62618942-62618964 TTCCAAACATTGGAAAAAAAAGG - Intergenic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
932146584 2:69324752-69324774 GTAAAAACCTTTGAAAAAGAAGG + Exonic
933948752 2:87310207-87310229 TCACAAACCTTGGCAAGAAAAGG - Intergenic
935944130 2:108270555-108270577 GTACAAAGTTTAGCAGAAAAAGG + Intergenic
936331445 2:111551389-111551411 TCACAAACCTTGGCAAGAAAAGG + Intergenic
936965250 2:118121486-118121508 GTATAATTCTTGGCAAAGAAAGG + Intergenic
941912865 2:170782705-170782727 ATACAAAAGTTGGCAAAATAGGG + Intergenic
943336942 2:186626992-186627014 GTAACAAACTTGGCAAACAAGGG - Intronic
945603742 2:211900469-211900491 GTACAAACCTAGAAAAAAAAAGG + Intronic
1170185472 20:13584984-13585006 ATACAAACCTTTTCAAAGAATGG + Intronic
1170382663 20:15778266-15778288 CTACCAACCTGGGAAAAAAATGG - Intronic
1173382681 20:42560310-42560332 GTACAAACCATGGAAAAGCAGGG - Intronic
1174130272 20:48339618-48339640 GTACAGACCTTGGCAACAAGAGG + Intergenic
1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG + Exonic
1176702151 21:10067452-10067474 GAACAAACCTTGGAACAAACTGG - Intergenic
1180722294 22:17918549-17918571 GTACACACCTGGGCAAACGAGGG + Intronic
1184048218 22:41985653-41985675 GTGAAAACCTAAGCAAAAAATGG + Intronic
949950931 3:9228218-9228240 GCACATACCTTGTCTAAAAAAGG + Intronic
951486105 3:23211909-23211931 GTACAAACTTTGGAAAAATGAGG + Intronic
951755628 3:26087872-26087894 GTCCCAACCATGGCAAAAAGAGG - Intergenic
953435651 3:42875165-42875187 AGACAAACCTTGGGAAAAGAAGG + Exonic
953861901 3:46551501-46551523 GCACAAAGCTTGGCAGAAGAAGG - Exonic
953994610 3:47510075-47510097 GTACAGAACTTAGCAAAAGAGGG - Intronic
954043612 3:47910027-47910049 CCAGATACCTTGGCAAAAAATGG - Intronic
955007178 3:54980596-54980618 GTAAAAACCTTGGTAAGTAAGGG + Intronic
956303812 3:67802625-67802647 GTACAAAACATGGAAACAAAAGG - Intergenic
956479998 3:69663808-69663830 GTACAAACCTTCAGAACAAAAGG - Intergenic
957833804 3:85558898-85558920 GTATAAACCATTGCCAAAAACGG + Intronic
965992272 3:174833500-174833522 GCACAAATCTTGGAAAATAAAGG + Intronic
966994555 3:185267058-185267080 TTTCATACCTTGACAAAAAAAGG + Intronic
967913535 3:194561087-194561109 GTCCAAACTTTGCCAAAATATGG + Intergenic
970055456 4:11966089-11966111 ATACAAACCTTGCGGAAAAAGGG - Intergenic
971610001 4:28711700-28711722 GCAGAAACCATGGCAAGAAAAGG + Intergenic
971987715 4:33847543-33847565 CTACAAGCCTAGTCAAAAAAAGG + Intergenic
973683633 4:53347170-53347192 GTAAAAACATTTGCAAAAAAGGG - Intronic
974770896 4:66412029-66412051 CTACAAACCTTCTAAAAAAAAGG + Intergenic
975043686 4:69775335-69775357 TTCCTAACCTTGGCATAAAAAGG - Intronic
977546086 4:98380097-98380119 AGATAAACCTTGGCAATAAATGG + Intronic
977909184 4:102512563-102512585 GGACAAGCCTTGGCAACATAGGG - Intronic
978628664 4:110717207-110717229 TTTCAAATCTTAGCAAAAAAGGG + Intergenic
980374327 4:131923741-131923763 GAACAAACCTTGGAACAAACTGG - Intergenic
980907289 4:138960973-138960995 GTACAAAGCATGGCATAAACTGG + Intergenic
980919278 4:139066407-139066429 GGACAAGCCTGGGCAAAACAGGG + Intronic
982356188 4:154472043-154472065 GTACAGCTCTGGGCAAAAAAAGG + Intronic
984516789 4:180751104-180751126 GAACAAACCTTGGAAATAGAAGG + Intergenic
986987340 5:13514531-13514553 GTTCAAACCGTGGCCAAAAGGGG + Intergenic
987771578 5:22312107-22312129 ATACAAACCCTGACCAAAAAAGG + Intronic
987913660 5:24184031-24184053 CAACAAACATTGGCAAACAATGG - Intergenic
988354550 5:30156383-30156405 GGCCAAACCCTGGCAAACAATGG + Intergenic
990629095 5:57648241-57648263 GTTCAAAACTTGGAAACAAAAGG - Intergenic
991712781 5:69424446-69424468 TTCAAAACCTAGGCAAAAAAAGG + Intronic
992025790 5:72667421-72667443 GCAGAACCCTTGGCAAAAAATGG - Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
997001518 5:129767582-129767604 ATGCAATCCTTGGCAAATAACGG + Intergenic
998894436 5:146783992-146784014 CTACAAAACTTGGCACACAAAGG + Intronic
1000602794 5:163295612-163295634 TTACAAAGCTTGGCACAATAGGG + Intergenic
1001762805 5:174222039-174222061 GTACAAACCCTGACAAATAGTGG - Intronic
1002818528 6:700732-700754 GTACACATCTTGACAATAAATGG + Intergenic
1002887137 6:1307690-1307712 ATACAAATCTGGGCAAAAGAGGG - Intergenic
1003298565 6:4855942-4855964 GAATCAACCTTGGCAACAAATGG - Intronic
1003676134 6:8206142-8206164 AGACAAACCTGGGCAACAAAGGG - Intergenic
1004929574 6:20449092-20449114 GTACAACCCTAAGCCAAAAAAGG - Intronic
1005416635 6:25606723-25606745 GAACAAGACTTGGCAAACAATGG + Intronic
1007384196 6:41509681-41509703 GCACAAACATTGCCAAACAAGGG - Intergenic
1008629656 6:53351041-53351063 GTACAATCCCTGGCATATAAGGG + Intergenic
1009565256 6:65304433-65304455 GCACAGACCTTGGAAAAAAGGGG + Intronic
1013371019 6:109471159-109471181 TTGCCAATCTTGGCAAAAAAGGG + Intronic
1013453667 6:110310349-110310371 ATACAATCTTTGGCATAAAAAGG + Intronic
1019193888 6:170269895-170269917 TTACAAACCTAGGCTAAAACAGG - Intergenic
1021246793 7:18273265-18273287 GGACCAGCCTGGGCAAAAAAGGG - Intronic
1022357178 7:29627093-29627115 TTACAAACCTAAGCACAAAATGG - Intergenic
1025273942 7:57556918-57556940 CTACAAGCCTAGCCAAAAAAAGG + Intergenic
1026860859 7:73787590-73787612 GTGAAAACCTTGGCAAGTAAGGG - Intergenic
1027798462 7:82722478-82722500 TAACAAATCTTGGAAAAAAAAGG - Intergenic
1028564566 7:92215163-92215185 ATACAAAAATTGGCAAAATATGG + Intronic
1030798454 7:113818748-113818770 ATACTAGCCTAGGCAAAAAAGGG - Intergenic
1030864345 7:114680497-114680519 GTACAAACCTTTGCCATAGAAGG - Intronic
1031118816 7:117697494-117697516 GTAGCAACCTAGGCAAAAATTGG - Intronic
1033871224 7:145755619-145755641 GTACAAACGGTGACAAAAAAGGG - Intergenic
1034356363 7:150453514-150453536 GTTCATACCTTTTCAAAAAATGG - Intronic
1036447588 8:8835820-8835842 GAACAAAAGTTGGCAAAACATGG + Intronic
1036545385 8:9763855-9763877 GCACATACCTAGGCAGAAAAAGG + Intronic
1042848937 8:73196468-73196490 GTACAAACTCTTGCAGAAAATGG + Intergenic
1044147368 8:88733616-88733638 ATACAAAACTTTGCAAATAAAGG + Intergenic
1044807051 8:96019063-96019085 ATACACACCTTAGCAAAAAAAGG - Intergenic
1045785315 8:105914567-105914589 GTACAAACATTGGTAAAACAAGG - Intergenic
1046268270 8:111859440-111859462 CTACAAACCTTGCCACAGAAGGG - Intergenic
1046589957 8:116194262-116194284 GTACAGATCTTGGGAAAATATGG - Intergenic
1047869133 8:129062966-129062988 GTTCAAACCTTCGTAAAAAATGG + Intergenic
1051011099 9:12415580-12415602 GTACCAACCAAGGAAAAAAAAGG + Intergenic
1051561310 9:18443665-18443687 GTACACACCTAGGCTGAAAAAGG - Intergenic
1052149183 9:25091897-25091919 ATACAAACTTTGGAAAAACATGG + Intergenic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1053639297 9:40053862-40053884 GAACAAACCTTGGAACAAACTGG - Intergenic
1053766781 9:41411242-41411264 GAACAAACCTTGGAACAAACTGG + Intergenic
1054320100 9:63650526-63650548 GAACAAACCTTGGAACAAACTGG - Intergenic
1054545448 9:66322756-66322778 GAACAAACCTTGGAACAAACTGG + Intergenic
1055312069 9:74993087-74993109 GTACAAAGCCTGGCAAACAATGG - Intronic
1056325892 9:85478750-85478772 GTCCACACCTTCGCAAAATATGG - Intergenic
1058441915 9:105017346-105017368 GTATAAACCATGGAGAAAAAGGG - Intergenic
1202787168 9_KI270719v1_random:37537-37559 GAACAAACCTTGGAACAAACTGG - Intergenic
1186426695 X:9468152-9468174 GAACAAACCTAGACAAGAAAAGG - Intronic
1186427371 X:9473470-9473492 GAACAAACCTAGACAAGAAAAGG - Intronic
1186900619 X:14051431-14051453 GTAGAAACCTTGGCAGAGTATGG + Intergenic
1187116118 X:16353077-16353099 GTACAGGCCTTGGCAAATTATGG - Intergenic
1187835449 X:23428401-23428423 CCACAAACATTGGGAAAAAACGG - Intergenic
1189396519 X:40628011-40628033 GTACAAAACTTGGGATCAAATGG - Intronic
1190415537 X:50176891-50176913 CTACTAACCTTGGCAAATCAGGG + Intergenic
1192091153 X:68157826-68157848 GTACTAACGATGGCAAAGAAAGG + Intronic
1193238562 X:79138954-79138976 TTACAAACCTTGTCCAAATATGG - Intergenic
1195177473 X:102324798-102324820 GTGCAAACACTGGCAGAAAATGG + Intronic
1195181391 X:102362295-102362317 GTGCAAACACTGGCAGAAAATGG - Intronic
1198737751 X:139806360-139806382 TTACAAACATTAGGAAAAAATGG + Intronic
1198844678 X:140898209-140898231 GTGAAAACCTTGGCAAGTAAGGG + Intergenic