ID: 1175256827

View in Genome Browser
Species Human (GRCh38)
Location 20:57652747-57652769
Sequence GCCTGATCCCGCGGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175256827 Original CRISPR GCCTGATCCCGCGGGGGCCC TGG Intronic