ID: 1175261620

View in Genome Browser
Species Human (GRCh38)
Location 20:57678043-57678065
Sequence GGGTGGATACAGTTAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175261620 Original CRISPR GGGTGGATACAGTTAGAAAA GGG Intronic
900813908 1:4828644-4828666 GGGTGGAAAGAGTCAGAAAATGG + Intergenic
901742115 1:11348915-11348937 AGGTGGATATGGTTATAAAAGGG - Intergenic
902167624 1:14585072-14585094 GGGAGGATACAGGGAGAAAGTGG + Intergenic
902464593 1:16608170-16608192 GGGTGGAAACAGAGAGAAATGGG + Intronic
903156215 1:21445535-21445557 GGGTGGAAACAGAGAGAAATGGG - Intronic
903679423 1:25087376-25087398 GGGTGGAGAAAGGTAGAAACTGG - Intergenic
904812224 1:33170861-33170883 GGGAGGATAAAGTGAGACAATGG + Intronic
904922279 1:34017803-34017825 GGGTGGATGCATTCAGAAGAAGG - Intronic
906832836 1:49051684-49051706 GGGAGGGTGCATTTAGAAAATGG - Intronic
907533709 1:55128178-55128200 GGGTGGGGACATTTATAAAATGG - Intronic
908564719 1:65342425-65342447 GGGAGGATACAGGGAGAAGATGG + Intronic
909260223 1:73479039-73479061 GTCTGGATACAGATAGAAAAAGG - Intergenic
909444468 1:75733106-75733128 GGTTGGAACCAGTTAGAAGAAGG - Intronic
910590726 1:88926188-88926210 GGGTCTATTCTGTTAGAAAAAGG + Intergenic
912336436 1:108867028-108867050 GAGGGGAGACAGTGAGAAAAGGG + Intronic
915715450 1:157940738-157940760 GTGTGGAGACAGTTAGACACTGG - Intergenic
915923747 1:159999676-159999698 ATGTGCATACAATTAGAAAAAGG + Intergenic
916469586 1:165109700-165109722 GGGTGGAGTCACTTCGAAAATGG - Intergenic
917054660 1:170967529-170967551 AGGTGGATGCACTTAGAGAAGGG - Intronic
918466372 1:184825412-184825434 GACTGGATACAGTTTGAAAAAGG + Intronic
919017618 1:192060332-192060354 GGGTGAATATAATCAGAAAAAGG + Intergenic
920456824 1:206107968-206107990 AAGTTGATACAGGTAGAAAAGGG + Intergenic
920655447 1:207870876-207870898 GGGAGGATACAGTGAGAAGATGG + Intergenic
923001319 1:230008595-230008617 GGGAGGATACAATGAGAAGATGG - Intergenic
924652928 1:245947163-245947185 GGCTGGCTATAGTTAGACAATGG - Intronic
1063000894 10:1921263-1921285 GCCTGGATGCAGTTAGAAAATGG + Intergenic
1063387916 10:5627942-5627964 GGGAGGACACAGTGAGAAAGTGG - Intergenic
1065425694 10:25600963-25600985 GGGTGTTTACAGGGAGAAAAAGG - Exonic
1065492502 10:26296126-26296148 GTGAGGATACAGGGAGAAAAAGG - Intronic
1067606867 10:47672592-47672614 TGGAGGAGACAGTTAAAAAATGG + Intergenic
1068371376 10:56120412-56120434 GGGTGTATACAGATATAAGATGG + Intergenic
1069280086 10:66644873-66644895 AGATGGATATAGTTATAAAAAGG - Intronic
1069873048 10:71544779-71544801 AGGTGGGGAGAGTTAGAAAACGG - Intronic
1071180964 10:82983054-82983076 GGGTCTAAACAGTTGGAAAAAGG - Intronic
1072085954 10:92079376-92079398 GGGGGTTTACAGTTACAAAAGGG + Intronic
1074212690 10:111351970-111351992 TGGTGGATACTCTTACAAAATGG + Intergenic
1074975033 10:118573013-118573035 GGGTGGTTAAAGTTGGCAAATGG - Intergenic
1075068172 10:119303669-119303691 GGGTGGAGATAGTTTGAAAGGGG + Intronic
1079363895 11:19792475-19792497 AGGTGCATACAGTTAGGACACGG - Intronic
1081190932 11:40102312-40102334 GGGTAGTTACAGTTAGAAATAGG - Intergenic
1081373892 11:42337025-42337047 GTGGGGATACAGTGAGAAGATGG + Intergenic
1084751183 11:71205237-71205259 GGGTGGTGACTGTGAGAAAAGGG - Intronic
1085074569 11:73579042-73579064 GTGAGGATACAGTGAGAAGAGGG - Intronic
1090339395 11:126003083-126003105 GGGTGGATACAGGAAGTATATGG - Intronic
1091046639 11:132331392-132331414 TATTGGATATAGTTAGAAAAGGG + Intronic
1093193071 12:16097529-16097551 GTGAGGTTACAGTGAGAAAATGG - Intergenic
1093505490 12:19860476-19860498 GGGGGTAAACTGTTAGAAAAGGG - Intergenic
1096352323 12:50910629-50910651 GGGTCTATTCTGTTAGAAAAAGG - Intergenic
1096755436 12:53795756-53795778 GGGTGGACACAGGGAGCAAATGG - Intergenic
1097073681 12:56376273-56376295 GTGAGGACACAGTGAGAAAATGG - Intergenic
1097166613 12:57089469-57089491 GGGTGGAGACTGATGGAAAAGGG + Intronic
1097519117 12:60645980-60646002 GGATGGCTACAGTCAGAGAATGG - Intergenic
1097907795 12:64938367-64938389 GGGTGGAGACAGTGAGATGAGGG - Intergenic
1099967963 12:89470863-89470885 GTGTGGAGACAGTTTGAAACGGG + Intronic
1100059770 12:90560293-90560315 GGGAAGATACAGTTGAAAAAAGG + Intergenic
1101761358 12:107661406-107661428 GGTTGGATCCAGTTGGAACAGGG - Intergenic
1104316318 12:127705667-127705689 GGGTGAATGCAGTTATAAAAGGG + Intergenic
1105804514 13:23945385-23945407 AGGTGGATACAGATGTAAAACGG + Intergenic
1107053958 13:36082893-36082915 AGATGGCTGCAGTTAGAAAAAGG + Intronic
1107285468 13:38785412-38785434 GTGTGGATACAGAGAGCAAACGG + Intronic
1107519781 13:41168077-41168099 GAGAGGATACAGTGAGAAGAGGG + Intergenic
1109470367 13:62796642-62796664 GTGAGGATACAGGGAGAAAATGG - Intergenic
1111529664 13:89520422-89520444 GGGTTCATTCTGTTAGAAAAGGG - Intergenic
1111954618 13:94742789-94742811 GTGAGGATACAATAAGAAAATGG - Intergenic
1112658646 13:101481387-101481409 GGGTGGCTATAGGAAGAAAAGGG + Intronic
1112718625 13:102216052-102216074 GGGTGCATACAGTTAGGCAGTGG + Intronic
1112735524 13:102412379-102412401 GGGATGAACCAGTTAGAAAATGG - Intergenic
1112764909 13:102730925-102730947 GGATGAATACAGTTAGATAAGGG + Exonic
1113409656 13:110073406-110073428 AGGGGGATACATTTAGGAAAAGG - Intergenic
1115977029 14:39008138-39008160 GTGTGGTTAGAGTGAGAAAAAGG - Intergenic
1117250856 14:53935941-53935963 GTGTGGATACAATGAGAAGATGG - Intergenic
1119226278 14:72946813-72946835 AGATGGATACAGGTTGAAAATGG + Intronic
1119626155 14:76178085-76178107 TGTTGGATACTCTTAGAAAACGG - Intronic
1119933877 14:78572973-78572995 AGGTGGAGACAATTAAAAAATGG + Intronic
1121896737 14:97655709-97655731 GTGAGGATACAGTTAGAAGACGG + Intergenic
1123440888 15:20290616-20290638 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1125344599 15:38706251-38706273 GGGTGCATACCGTTACACAAAGG - Intergenic
1126564257 15:50078080-50078102 TGCTGAATACAGGTAGAAAAAGG + Intronic
1127460308 15:59192674-59192696 AGGTGGATAGAGTTTGAAATGGG + Intronic
1128374994 15:67067719-67067741 GGGTGGATCCAGTCAATAAAGGG + Intronic
1129903209 15:79167530-79167552 GGGTTTATACAGTTTGAAAGTGG + Intergenic
1131787953 15:95933389-95933411 GGATGGGTCCAGTGAGAAAAAGG + Intergenic
1132130840 15:99277429-99277451 GGTAGGAGACAGGTAGAAAAGGG - Intronic
1134070135 16:11255677-11255699 CAGTGGACACAGCTAGAAAATGG + Intronic
1134567967 16:15267225-15267247 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134567988 16:15267450-15267472 TGGTAGATACAGTTAGTTAAGGG - Intergenic
1134567998 16:15267576-15267598 TGGTAGATACAGTTAGTTAAGGG - Intergenic
1134734438 16:16488779-16488801 TGGTAGATACAGTTAGTTAAGGG + Intergenic
1134734447 16:16488905-16488927 TGGTAGATACAGTTAGTTAAGGG + Intergenic
1134734468 16:16489128-16489150 TGGTTGATACAGTTAGTGAAGGG + Intergenic
1134932998 16:18222778-18222800 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134933016 16:18222964-18222986 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134933034 16:18223150-18223172 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134933055 16:18223375-18223397 TGGTAGATACAGTTAGTTAAGGG - Intergenic
1134933064 16:18223501-18223523 TGGTAGATACAGTTAGTTAAGGG - Intergenic
1135383832 16:22018249-22018271 GGGTGGGTCAAGTAAGAAAAAGG + Intronic
1135893094 16:26374602-26374624 GGGTGGATACATGGATAAAAGGG + Intergenic
1140851782 16:78941542-78941564 GGGGGGATAGAGTTATGAAATGG + Intronic
1140997834 16:80278392-80278414 GGATGGATACAGTTATGAGAAGG - Intergenic
1147159932 17:38563827-38563849 GGTTGGAGAGAGTTAGAGAAGGG + Intronic
1147691138 17:42315461-42315483 GGGTGGCTAGAGGGAGAAAAAGG - Exonic
1148811546 17:50295927-50295949 GAGTGGATACAGTTGTAAACAGG + Intergenic
1150483954 17:65531435-65531457 GAGAGGAGACAGTGAGAAAATGG + Intronic
1155379162 18:25199373-25199395 GGGTGGAAACAGCTATAAGAAGG + Intronic
1156047432 18:32892793-32892815 GAGTGGGTAGAGTTAGAAAAGGG + Intergenic
1156707626 18:39902065-39902087 AGGTGGATACAAATAAAAAATGG + Intergenic
1157899089 18:51496638-51496660 GGGTAGATGCAGTTTGGAAAAGG + Intergenic
1158087005 18:53662919-53662941 GGATGGGTACAATTAGAGAATGG - Intergenic
1160076902 18:75686221-75686243 GGGTCTATACAGTTAGATATGGG - Intergenic
1161725144 19:5924303-5924325 GGGTGGAATCAGGAAGAAAAAGG + Intronic
1162141889 19:8590031-8590053 GGGGGGATGGAGTCAGAAAAGGG + Intronic
1163037907 19:14582060-14582082 GGCTGGAAACAGCAAGAAAATGG - Intergenic
1167483046 19:49744995-49745017 GGGTGGAATCAATTAGAGAAGGG - Intronic
924970521 2:122891-122913 GGGGAGAGACAGTTAGAAACTGG - Intergenic
925098607 2:1227551-1227573 GGGTGGATACCGTGGGGAAACGG - Intronic
926347019 2:11956253-11956275 GGGTGGGCACAGGCAGAAAAAGG - Intergenic
926447778 2:12965285-12965307 GGCTGGCTAGAGTTAGAAACAGG + Intergenic
928732997 2:34254615-34254637 GGGTGGAGACAGATATAAAAGGG - Intergenic
931176944 2:59863667-59863689 GGGTGGATACTGAAAGAACAAGG - Intergenic
932824247 2:74925388-74925410 GGGGGGACACAGTTGGAAAAAGG - Intergenic
934319918 2:91962804-91962826 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
938782664 2:134599465-134599487 GGGAGGATACAATGAGAAGATGG + Intronic
939322250 2:140639836-140639858 GGCTGGAGAGAGTTAGAAAGAGG - Intronic
941252676 2:163185999-163186021 TGGTGGATAAAAGTAGAAAATGG + Intergenic
941856729 2:170238855-170238877 AGGTGGATAAAGGAAGAAAAGGG - Intronic
942121516 2:172782489-172782511 GGGTTGAAAGAGTTAGAGAAGGG - Intronic
943706769 2:191043998-191044020 GGGTGGGTACAGAGAGGAAAAGG + Intronic
943790324 2:191924133-191924155 GGGTAGACAGAGTTAGAGAAGGG - Intergenic
943888509 2:193254981-193255003 GGGTGCAAACAATTAGAATAAGG - Intergenic
944402658 2:199345891-199345913 GGATGGACACAGATTGAAAAAGG - Intronic
944541970 2:200762697-200762719 GGGTGGCCAAAGATAGAAAAAGG - Intergenic
945445988 2:209939353-209939375 GGGTTGATAAAGTCGGAAAAGGG - Intronic
946150001 2:217758024-217758046 GTGGGGATACAGTGAGAAGATGG + Intergenic
948484985 2:238274791-238274813 GGGTTGATACAGACAGAACAAGG - Intronic
1168871812 20:1135433-1135455 GGGTGCATGGAGTTAGAAAGTGG + Intronic
1169492099 20:6080019-6080041 AGGTGGTTACAGTTTGAAACAGG + Intronic
1170308384 20:14965402-14965424 GGTTGGAAACAATTAGAATATGG - Intronic
1174945093 20:54976313-54976335 GGGTGGTTAGAGAGAGAAAAAGG + Intergenic
1175261620 20:57678043-57678065 GGGTGGATACAGTTAGAAAAGGG + Intronic
1176697961 21:10003328-10003350 GGGTGGAAACACTTAGAACAGGG + Intergenic
1177353914 21:19982046-19982068 GGGTGCATAAAGGTAGAAAAGGG - Intergenic
1177480710 21:21683430-21683452 TGGTGGACACAGTTAGATAATGG - Intergenic
1177605683 21:23375287-23375309 GGGGGGATACTGTCAGAAAGAGG - Intergenic
1178041525 21:28645194-28645216 GGATGCATGCAGTTAGTAAAAGG - Intergenic
1180308167 22:11146849-11146871 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1180546643 22:16508662-16508684 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1181537702 22:23555245-23555267 GGGTCGATGCAGTCAGAGAAGGG + Intergenic
1182212539 22:28688687-28688709 GGGAGGAAACAGTGGGAAAAAGG + Intronic
950318550 3:12027703-12027725 AGATGCATACAGTTAGAAAGTGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951676933 3:25251531-25251553 GGATGGATATAATTACAAAATGG - Intronic
952753657 3:36846979-36847001 GGGTGGATACTGTCTGAAAACGG - Intronic
953360312 3:42289990-42290012 GAGTGGATACATTTAGGAAAGGG + Intergenic
954954441 3:54507149-54507171 GGGTGGACAGAGGTGGAAAATGG - Intronic
956069716 3:65435017-65435039 ATGAGGATACAGTGAGAAAATGG + Intronic
957169540 3:76720176-76720198 GGGAGGATACAGCAAGAAGAGGG + Intronic
962309016 3:134312894-134312916 GGTTGGAAACTGTGAGAAAATGG - Intergenic
963147092 3:142005591-142005613 GTGTGTATATAGCTAGAAAATGG - Intronic
964002951 3:151798102-151798124 GGATGAATAAAGTTAGAACATGG - Intergenic
970738687 4:19206083-19206105 GTGTGGAGACAGTCAGAAAGGGG + Intergenic
970813429 4:20124428-20124450 CAGTGGATATAGTTAGAAAAGGG - Intergenic
971208465 4:24592679-24592701 TGGAGCATACAGTTAGATAAGGG + Intergenic
972226644 4:37020802-37020824 TGGTGGAGAAAGTTAGAAAGAGG + Intergenic
975181274 4:71348506-71348528 GGGAGGATACAGGGAGAAGAAGG + Intronic
976155010 4:82134515-82134537 GGGTGCATACTCTAAGAAAAGGG + Intergenic
976969982 4:91092691-91092713 GGGTGGATACAGTTACCAGATGG - Intronic
978889508 4:113806798-113806820 CTGTGGACACAGTTAGACAATGG - Intergenic
979021787 4:115509658-115509680 GAGAGGACACAGTGAGAAAATGG + Intergenic
979797713 4:124867711-124867733 GTGTGGATACAGTGGAAAAAGGG + Intergenic
980370509 4:131863190-131863212 GGGTGGAAACACTTAGAAAAGGG + Intergenic
980722711 4:136718740-136718762 GGGTAGTTACAGTTAGAAACAGG - Intergenic
981512595 4:145573990-145574012 GAGATGATACAGCTAGAAAATGG - Intergenic
982143840 4:152359838-152359860 GGGTGGAGTGAGTCAGAAAATGG + Intronic
982333358 4:154207031-154207053 GTGTGCAGACAGTCAGAAAATGG - Intergenic
984489509 4:180415280-180415302 AGGTAGAAGCAGTTAGAAAAGGG + Intergenic
984963579 4:185121518-185121540 GTGTTGATACAGTTTGAATATGG + Intergenic
987514279 5:18886029-18886051 GGGTGGTGACAGTGAAAAAAGGG + Intergenic
987910216 5:24133161-24133183 GAGTGGATTCAGTTATAAAGAGG + Intronic
988694325 5:33604788-33604810 GGGTGCATACAGACAGAAGATGG + Intronic
988969909 5:36456883-36456905 GGGAGGAGCCAGTTAGAACAAGG + Intergenic
989698139 5:44228440-44228462 GAGTGGAGACAGTTGGAAAAGGG + Intergenic
992064773 5:73096481-73096503 GGCTGGTAAGAGTTAGAAAATGG + Intergenic
992987686 5:82250475-82250497 GTGGGGATACAGTGAGAAGATGG - Intronic
993764240 5:91835490-91835512 GGGTGGATAAAGTTAGGGAGAGG + Intergenic
993834570 5:92801946-92801968 GAGTGGATACAGCTACAACAGGG + Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
995258779 5:110077237-110077259 GGGTGGAGATGGGTAGAAAATGG - Intergenic
995456559 5:112359031-112359053 GGGTAGGTACTGTTTGAAAAGGG + Intronic
996259089 5:121443682-121443704 GGGTAGAGTGAGTTAGAAAATGG + Intergenic
996806584 5:127462319-127462341 GGGTGGATACACAAAGACAAGGG + Intronic
1000438359 5:161240871-161240893 GGGTAGATACAGGGAGAGAAGGG - Intergenic
1000543749 5:162573062-162573084 ATGTGGGTATAGTTAGAAAATGG + Intergenic
1001191148 5:169632494-169632516 GGGTAGAAACAGTCAGAAGAGGG + Intergenic
1001713920 5:173799213-173799235 GTGAGGATCCAGTGAGAAAATGG + Intergenic
1004911867 6:20293523-20293545 GGGTGGTTACAGTTTTAAACAGG + Intergenic
1005389919 6:25322597-25322619 ATGTGGAGACAGTTAGTAAAGGG - Intronic
1007465070 6:42046023-42046045 GGGTGGCTGCACTGAGAAAACGG - Intronic
1007903630 6:45436517-45436539 GGGTGGGTGCAGTTTGAATAGGG - Intronic
1011984761 6:93429648-93429670 GCGAGGATACAGCTAGAAGATGG + Intergenic
1013442160 6:110181218-110181240 GTGTTAATACAGTGAGAAAAAGG + Intronic
1013919092 6:115379121-115379143 GTGAGGATACTGTAAGAAAATGG + Intergenic
1016511177 6:144845017-144845039 GTGTAGACACAGTTAAAAAACGG - Intronic
1016540385 6:145157883-145157905 GTGAGGATACAGTGAGAAGATGG + Intergenic
1017337134 6:153274507-153274529 AGTTGAATTCAGTTAGAAAAAGG - Intergenic
1019199750 6:170304999-170305021 GTGAGGATACAGTGAGAAGATGG - Intronic
1020836998 7:13166234-13166256 GGGGGGATACAGGAAGAATAAGG - Intergenic
1021536623 7:21712546-21712568 GCATGGCTACTGTTAGAAAAAGG - Intronic
1022155064 7:27652679-27652701 GTGAGGATACAGTGAGAAAATGG - Intronic
1024855115 7:53769956-53769978 GTGTGGATAGAGGTAGGAAAGGG - Intergenic
1025618493 7:63145514-63145536 GGAAGGATACAGCTAAAAAAAGG + Intergenic
1025621915 7:63180827-63180849 AGATCTATACAGTTAGAAAAAGG - Intergenic
1030244914 7:107372780-107372802 GGGTGGAAACAGATATAAATAGG + Intronic
1035460880 7:159038080-159038102 GGGTGGATACACTTATATATGGG + Intronic
1035836378 8:2757630-2757652 GGGTGGAAACAGAAAAAAAATGG + Intergenic
1037035430 8:14160871-14160893 GGATGGATTCATTTAGACAAGGG - Intronic
1038941043 8:32306288-32306310 GGGTTGATACAGAAAGAAACTGG - Intronic
1039423855 8:37469019-37469041 GGCTGGAAACAGATAGAAAGAGG + Intergenic
1041426577 8:57727386-57727408 GGATGGATACAGGAACAAAATGG + Intergenic
1041607767 8:59803879-59803901 AAGTGGATATAGTTATAAAAGGG - Intergenic
1041759921 8:61354821-61354843 GGGAGGAGAGAGTTATAAAAGGG + Intronic
1042016161 8:64315260-64315282 AGGATGATACAGTTATAAAATGG - Intergenic
1042134317 8:65618629-65618651 GTGTTGAGACTGTTAGAAAATGG - Intronic
1043050407 8:75378159-75378181 AGGTGGATACAGTGAGTGAAAGG - Intergenic
1044772284 8:95648949-95648971 AGGTGGATACTGGTGGAAAAAGG - Intergenic
1045233218 8:100326098-100326120 GGGTGGAGACAGACTGAAAACGG - Intronic
1047035062 8:120928574-120928596 GGATAGATACAATGAGAAAAAGG + Intergenic
1050262846 9:3859304-3859326 AGGTGCAGACACTTAGAAAATGG - Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1053635090 9:39989675-39989697 GGGTGGAAACACTTAGAGCAGGG + Intergenic
1053770840 9:41474636-41474658 GGGTGGAAACACTTAGAACAGGG - Intergenic
1054208797 9:62261023-62261045 GGGTGGAAACACTTAGAGCAGGG - Intergenic
1054316007 9:63587118-63587140 GGGTGGAAACACTTAGAACAGGG + Intergenic
1054549573 9:66386460-66386482 GGGTGGAAACACTTAGAACAGGG - Intergenic
1057097369 9:92324608-92324630 GGGTGGAGACAATTAGGAAGAGG - Intronic
1059616256 9:115954641-115954663 GGGTGTATATACTAAGAAAAAGG + Intergenic
1061621789 9:131815267-131815289 AGTAGGCTACAGTTAGAAAACGG + Intergenic
1185956705 X:4498712-4498734 GGGTGTGGACAGTTAGAAAATGG + Intergenic
1186723495 X:12330814-12330836 GGGTGAATACAGGTAGCAAGAGG - Intronic
1188615047 X:32147841-32147863 GAGTGTATACAGTTAGAAAATGG - Intronic
1193808252 X:86018901-86018923 AGGTAGATACAGTTATAAAAAGG + Intronic
1196505696 X:116438598-116438620 GGGTAGACTCAATTAGAAAAAGG + Intronic
1197419169 X:126216770-126216792 GGATGGATACAGTGATAAATGGG + Intergenic
1197806576 X:130403699-130403721 GGGTGGAAACAGTAAGCAACAGG - Intronic
1200395185 X:155981963-155981985 GAGTTCATACAGTTAGAAAGTGG + Intergenic
1201187444 Y:11417900-11417922 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1201390831 Y:13495738-13495760 TTGTGGAAACAGTTAGGAAAAGG - Intergenic
1201473667 Y:14359023-14359045 GGGTGGAGACAGGGAGAGAAGGG + Intergenic
1202088182 Y:21161129-21161151 GGGAGGGTAGAGTTAGAACAGGG + Intergenic