ID: 1175262347

View in Genome Browser
Species Human (GRCh38)
Location 20:57682471-57682493
Sequence GGTCCTAGGCGCCGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175262345_1175262347 -10 Left 1175262345 20:57682458-57682480 CCTGGAGTGTCGGGGTCCTAGGC No data
Right 1175262347 20:57682471-57682493 GGTCCTAGGCGCCGGCCCAGAGG No data
1175262338_1175262347 7 Left 1175262338 20:57682441-57682463 CCCAGGTTCTGGGTCTCCCTGGA No data
Right 1175262347 20:57682471-57682493 GGTCCTAGGCGCCGGCCCAGAGG No data
1175262343_1175262347 -9 Left 1175262343 20:57682457-57682479 CCCTGGAGTGTCGGGGTCCTAGG No data
Right 1175262347 20:57682471-57682493 GGTCCTAGGCGCCGGCCCAGAGG No data
1175262339_1175262347 6 Left 1175262339 20:57682442-57682464 CCAGGTTCTGGGTCTCCCTGGAG No data
Right 1175262347 20:57682471-57682493 GGTCCTAGGCGCCGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175262347 Original CRISPR GGTCCTAGGCGCCGGCCCAG AGG Intronic