ID: 1175263158

View in Genome Browser
Species Human (GRCh38)
Location 20:57687390-57687412
Sequence TGACCTGGTTGGGTTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175263158_1175263163 -9 Left 1175263158 20:57687390-57687412 CCCAGAGCAACCCAACCAGGTCA No data
Right 1175263163 20:57687404-57687426 ACCAGGTCAGGAAAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175263158 Original CRISPR TGACCTGGTTGGGTTGCTCT GGG (reversed) Intronic