ID: 1175264076

View in Genome Browser
Species Human (GRCh38)
Location 20:57692131-57692153
Sequence CAAGGGCTCAGCTCAGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264076_1175264082 24 Left 1175264076 20:57692131-57692153 CCCAGGACTGAGCTGAGCCCTTG 0: 1
1: 1
2: 1
3: 36
4: 290
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264076_1175264081 23 Left 1175264076 20:57692131-57692153 CCCAGGACTGAGCTGAGCCCTTG 0: 1
1: 1
2: 1
3: 36
4: 290
Right 1175264081 20:57692177-57692199 TTACGATGCCCCCTGTGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264076 Original CRISPR CAAGGGCTCAGCTCAGTCCT GGG (reversed) Intronic
900471552 1:2857505-2857527 CCAGGGCTGAGCTCAGTGCTGGG + Intergenic
900707043 1:4087270-4087292 CAGGTGCTCAGCTCTGTGCTGGG + Intergenic
901462589 1:9400554-9400576 TATCAGCTCAGCTCAGTCCTAGG - Intergenic
901740848 1:11340707-11340729 AAAGGGCTCTGCACAGTGCTTGG + Intergenic
901881473 1:12196504-12196526 CGAGGGAACAGCTCAGCCCTGGG + Intronic
902806478 1:18864280-18864302 CAAGGGCTCAGCGCAGCACCTGG - Intronic
902834123 1:19035806-19035828 CCAGGGCGCAGCTCAGCACTAGG + Intergenic
903002695 1:20277585-20277607 CAAGGGCTCAGCACAGGGCCTGG - Intergenic
903175617 1:21578404-21578426 CAAAGACTCAGCTCTGTCCTCGG - Exonic
903288028 1:22289230-22289252 GAAGCGCTCAGCACAGTCTTGGG + Intergenic
903566191 1:24267522-24267544 CATGGGCTTAGCACAGTTCTTGG + Intergenic
903951142 1:26996573-26996595 AAAGAGCTGAGCTCAGGCCTTGG + Intronic
904380627 1:30108306-30108328 AAAGGGCTCTTCTCAGTCCCTGG - Intergenic
904461667 1:30684447-30684469 CCAGGGCCCAGCACAGTCTTGGG - Intergenic
906259591 1:44376850-44376872 CAAGGGCCCAGCACAGTCCCTGG + Intergenic
906295614 1:44647284-44647306 CAAATTCTCAGCTTAGTCCTTGG + Intronic
906933395 1:50190838-50190860 CAAGGGCTTAGCACAGTACCTGG - Intronic
906944607 1:50285040-50285062 AAGAGGCTCAGCTCAGTCCTAGG - Intergenic
907946197 1:59138793-59138815 GAAAGGCTTAGCTGAGTCCTTGG - Intergenic
908043344 1:60140890-60140912 CAATGGCTCAGCTCTGACCCTGG - Intergenic
908751671 1:67430126-67430148 CAAGAGCGCAGCTCAGGCCGCGG - Exonic
909062225 1:70892328-70892350 AAAGTGCTCAGCACAGTGCTTGG + Intronic
910798395 1:91121032-91121054 CCAGGGCTGAGCTCAGCACTGGG + Intergenic
911682516 1:100733667-100733689 CAAGTACTTAGCTCAGTGCTTGG + Intronic
915211531 1:154313209-154313231 CAAAGGCTTATCTCAGTCCGGGG - Intergenic
919606079 1:199686445-199686467 CCAAGGCTCAGCACAGTGCTTGG - Intergenic
919882668 1:201911152-201911174 CCAGAGCTGAGCCCAGTCCTTGG - Intronic
920496402 1:206457993-206458015 CCAGGGTTCAGCCCAGTGCTGGG + Intronic
920823859 1:209406004-209406026 AAAGTGCTAAGCTCAGTCCTTGG - Intergenic
921562945 1:216680213-216680235 AAAGTGCTCAGCTCAGTGCCTGG - Intronic
921723296 1:218497416-218497438 AAAGCCCTCAGCTCAGTACTTGG - Intergenic
922675324 1:227545927-227545949 CAATGGCACAGTTAAGTCCTTGG + Intergenic
923462854 1:234222255-234222277 ACATGGCTCAGCTCATTCCTGGG - Intronic
923708526 1:236366330-236366352 AAAGGTCTCAGCTCAGTGGTAGG - Intronic
924104198 1:240634344-240634366 CGAGTGCTCAGCACAGTACTTGG + Intergenic
924800833 1:247328956-247328978 CAAAGGCTCAACTTAGGCCTTGG + Intronic
1063958562 10:11287030-11287052 CACGGGCGCAGCTCAGTGCCTGG - Intronic
1069610889 10:69771867-69771889 CAAGGGCTTAGTTCAGTACCTGG + Intergenic
1069625172 10:69863350-69863372 CACGGGCTCCCCTCAGACCTTGG - Intronic
1069650373 10:70042803-70042825 CTGGGCCTCAGCTCAGCCCTTGG - Intergenic
1069714597 10:70512597-70512619 CAAGGGCCAAGCTCATTCATAGG + Intronic
1069986291 10:72286467-72286489 GAATGGCTCAACTCAGTGCTAGG + Intergenic
1070718800 10:78742206-78742228 AAAGGGCTCAGCACAGTGCTTGG - Intergenic
1070827236 10:79398387-79398409 AAAGGTCTCAGCTCAGTGGTTGG + Intronic
1071371604 10:84957227-84957249 CAGGAGCTGAGCTCTGTCCTGGG - Intergenic
1071500276 10:86198520-86198542 CAGGGGCTTAGCTCAGTACCTGG - Intronic
1071518415 10:86314395-86314417 CAAGGGCTCCTCCCACTCCTTGG + Intronic
1072189881 10:93070509-93070531 TAAGGGGTCAGCTCAGGCCTAGG - Intergenic
1072542765 10:96410852-96410874 AAATGGATCAGCTCAGTGCTTGG + Intronic
1073006893 10:100331133-100331155 CCATGGCTCTGCTTAGTCCTGGG + Intergenic
1075322460 10:121503018-121503040 CAAGAACTCTGCTCAGTCCTGGG + Intronic
1075604348 10:123793503-123793525 CTTTGGCTCAGCTCAGACCTGGG - Intronic
1075915266 10:126161247-126161269 CAGGGGCTCAGCACAGTACCTGG - Intronic
1077482554 11:2822743-2822765 CAGGGGCTCAGCTCAGAACAGGG + Intronic
1077541128 11:3147027-3147049 CGAGGCCCCAGCTCTGTCCTGGG + Intronic
1078626994 11:12966978-12967000 GAAGGGTTCAGCTTTGTCCTTGG - Intergenic
1078658110 11:13261174-13261196 CCAGGGCTCAGCTCTGTCTGCGG - Intergenic
1081245732 11:40764239-40764261 GAAGGGCCCAACCCAGTCCTGGG + Intronic
1081580289 11:44347205-44347227 CTAGGCCTCTGCTCAGCCCTGGG + Intergenic
1081580853 11:44350640-44350662 CCTGGGCTCAGCCCAGCCCTGGG + Intergenic
1081750401 11:45506481-45506503 CCAGGGCCCAGCACAGTGCTAGG - Intergenic
1083898951 11:65634493-65634515 CCAGAGCCCAGCTCAGACCTGGG - Intronic
1084023177 11:66430503-66430525 CAAGGGCTTTGCTGGGTCCTGGG + Intergenic
1084540283 11:69782222-69782244 CATGGGCTCAGCTCACCCCATGG + Intergenic
1084728088 11:70954951-70954973 AAAGGGCTCAGCACAGGACTAGG + Intronic
1085454410 11:76657580-76657602 CCAGGCCTCAGCCCAGGCCTCGG - Exonic
1085465609 11:76721484-76721506 CAAGGGCTCCCTTCTGTCCTGGG - Intergenic
1085534876 11:77211781-77211803 TCAGGGCTGGGCTCAGTCCTGGG - Intronic
1087283205 11:96235339-96235361 CAACTACTCAGCTCTGTCCTTGG - Intronic
1089161574 11:116441835-116441857 CAAGGGCTCTGCCATGTCCTTGG - Intergenic
1089879062 11:121756012-121756034 CTAGAGCTCAGCTCTGGCCTTGG + Intergenic
1089977624 11:122746144-122746166 CTGGGCCTTAGCTCAGTCCTAGG - Intronic
1090075387 11:123577472-123577494 GAAGGGCTCAGATCACTCCTCGG + Exonic
1091780627 12:3212609-3212631 CAAGAGCTCAGCTGAACCCTGGG - Intronic
1092214670 12:6672582-6672604 CAGGGGCTCAGCTCTCTGCTGGG + Intronic
1096534028 12:52259369-52259391 AAAGGCCTCAGCACAGTACTAGG - Intronic
1096559655 12:52426468-52426490 CAAGTGCTCACCTCTGTGCTAGG + Intronic
1096583378 12:52602667-52602689 CCAGTGCTCAGCCCAGGCCTTGG + Intergenic
1097573095 12:61356880-61356902 CCTGGGCTCAGCTCTGTCTTGGG + Intergenic
1098364736 12:69690458-69690480 CCTGAGCACAGCTCAGTCCTCGG + Intronic
1102235503 12:111291924-111291946 CAAGGGCTCATCCCAGGGCTTGG - Intronic
1102956666 12:117063441-117063463 GAAGAGCCCAGCACAGTCCTCGG - Intronic
1103209648 12:119156998-119157020 CTGGGGCCCAGCTCAGGCCTGGG + Exonic
1103940604 12:124499433-124499455 CAGGGGCTCTGCCCAGCCCTGGG + Intronic
1104031450 12:125067990-125068012 CCAGTGCTCAGCTCTGCCCTGGG + Intronic
1104384471 12:128338544-128338566 CATGTGCTCAGCTCTGTCCTTGG - Intronic
1104744604 12:131202999-131203021 CAAGGCCCCTGCTCAGCCCTGGG - Intergenic
1104913309 12:132250805-132250827 CAAAGGCTCAGCTCATGCCGAGG + Intronic
1107447194 13:40479883-40479905 CAAGGACTGAGATCAGTCATAGG + Intergenic
1117015142 14:51510182-51510204 CAAATGCTCAGCTCAGAGCTGGG - Intronic
1118062778 14:62158885-62158907 CAACTGCTCAGCTCAGTGGTGGG + Intergenic
1119267203 14:73270004-73270026 CCAGGGCCCAGCTCAGTGCTTGG + Intronic
1119323346 14:73744424-73744446 CGGGGGCTCAGCTCTGACCTGGG + Intronic
1119756278 14:77122137-77122159 CAAGGCCACAGGTCAGCCCTGGG + Intronic
1119948746 14:78722745-78722767 CAAGTGCTCAACACAGTCCCTGG - Intronic
1120922003 14:89763880-89763902 AAAGGGCTCAGCTCACCCCATGG - Intergenic
1121354908 14:93206398-93206420 CCAGGGCTCAGCTCAGGGTTTGG + Intronic
1121580286 14:95025000-95025022 CTAGGGCCAAGCTCTGTCCTAGG + Intergenic
1122092981 14:99352250-99352272 CAGGGGCTCTGCTCAGCCATGGG + Intergenic
1122121062 14:99553777-99553799 CAGGGGCTCAGCCCAGCCCTGGG - Intronic
1122974012 14:105163730-105163752 CAGGGACCCTGCTCAGTCCTGGG + Intronic
1122974024 14:105163762-105163784 CAGGGACCCAGCTCAGGCCTGGG + Intronic
1123065457 14:105616802-105616824 CAGGGGCTCAGCTGAAACCTGGG + Intergenic
1123094683 14:105761308-105761330 CAGGGGCTCAGCTGAAACCTGGG + Intergenic
1124649677 15:31465488-31465510 CCAGGGCTCAGCTCTGCCCCAGG - Intergenic
1125157716 15:36607871-36607893 CACTGGCTCAGTTCAGTCCTAGG + Intronic
1128380257 15:67107093-67107115 CCAGGGCTCAGCACAGTACCTGG + Intronic
1128577225 15:68784346-68784368 CAGGGGCCCAGCTGAGGCCTTGG - Intronic
1128579458 15:68798700-68798722 CAGGGGCTGAGCTCAGGTCTGGG - Intronic
1129857636 15:78836158-78836180 CAAGAGCACAGCTCAGAGCTGGG - Intronic
1131076170 15:89496280-89496302 CAAGGGCTCGGCCCAGAGCTGGG - Intronic
1131760454 15:95617176-95617198 AAAGGGCTAAGCTCAGTGCTTGG + Intergenic
1131801364 15:96072962-96072984 CAAGAGCTTAGCCCAGGCCTGGG + Intergenic
1132047203 15:98574179-98574201 CCAGTGCTCAGCACAGTGCTTGG + Intergenic
1133345944 16:5070569-5070591 CCTGGGCTCAGCTCAGGGCTTGG - Intronic
1133749015 16:8710207-8710229 AAAGTACTTAGCTCAGTCCTAGG + Intronic
1133984775 16:10660245-10660267 AAAGGGCTCTCCTCAGTCTTTGG + Intronic
1135462864 16:22660182-22660204 CAAGGACTCAGCCCTGCCCTTGG + Intergenic
1137548616 16:49421428-49421450 CAAGGGCACTGCTCAGGCATAGG + Intergenic
1137575793 16:49599387-49599409 CAAGTGCTCAGCACAGTCCCAGG - Intronic
1137614386 16:49838239-49838261 CAGGGGCTGAGCACAGTTCTGGG + Intronic
1138208386 16:55142287-55142309 CAAGTGCTCAGCATAGGCCTGGG + Intergenic
1139336247 16:66233637-66233659 GATGGGCTCAGCTCACTCGTTGG - Intergenic
1140465121 16:75175148-75175170 CAAGGCTTCAGGTCTGTCCTGGG + Intergenic
1141109249 16:81258504-81258526 CCAGGGCCCCGTTCAGTCCTGGG - Intronic
1141156961 16:81603867-81603889 CAAGGACTCAGCACAGTACCTGG - Intronic
1141525405 16:84607791-84607813 AAAGGACTCAACTCAGTACTTGG + Intronic
1141617063 16:85215947-85215969 CAAGGGCTCTGCTCACAGCTGGG - Intergenic
1141943010 16:87290883-87290905 CCAGTGCTCAGCCCAGTGCTGGG - Intronic
1142181279 16:88672019-88672041 CATGGTCACAGCTCAGCCCTGGG - Intergenic
1142246096 16:88970751-88970773 CCAGGGCTCAGCACCCTCCTGGG + Intronic
1142266949 16:89068324-89068346 CAAGGGCTCTGCTGCGTGCTTGG + Intergenic
1142888417 17:2927719-2927741 CATGGGCTTTGCTCAGCCCTGGG + Intronic
1145734333 17:27216421-27216443 AAAGGGCTCAGCACAGTGCCTGG - Intergenic
1145768824 17:27478120-27478142 CCAGGGCTTAGCCCAGTACTTGG + Intronic
1146305939 17:31729858-31729880 CAAGGGCTCCCCTGAGTCCCAGG - Intergenic
1147966745 17:44198315-44198337 CAGGGCCTGAGCTCAGGCCTGGG - Intronic
1148566994 17:48639236-48639258 CCAGAGCTCAGCCCAGTGCTGGG - Intergenic
1150656461 17:67042926-67042948 CGAGGGTTCAGCTCAGCCCTGGG + Intergenic
1151576683 17:74955964-74955986 GGAGGGGTCAGCTCACTCCTGGG + Intronic
1151961484 17:77408122-77408144 CCAGTGCCCAGCTCAGTTCTGGG + Intronic
1152599753 17:81256238-81256260 CAAGGCCACAGCTCAGGGCTCGG + Intronic
1152669411 17:81593336-81593358 CAAGGGCTGAGCACAGGGCTGGG - Intronic
1155343904 18:24839633-24839655 CAAGTACTCATCTTAGTCCTAGG - Intergenic
1156783793 18:40883814-40883836 CGAAGGCTCAGCTCCGTCATCGG - Intergenic
1157696554 18:49728203-49728225 CCAGGGCTCAGCCCAGTTCTTGG - Intergenic
1157735030 18:50039879-50039901 GACTGGCTTAGCTCAGTCCTTGG - Intronic
1158599330 18:58843651-58843673 CCAGGGTTAAGCTAAGTCCTGGG + Intergenic
1160443980 18:78913278-78913300 CCAGGGCTCCGCTCAGCCCGAGG + Intergenic
1161812285 19:6477554-6477576 CAAGGGCTCAGGTCAGTCCTGGG + Intronic
1161864975 19:6826973-6826995 CTAGGGCTCAGCCCAGGGCTGGG - Intronic
1162257007 19:9498738-9498760 CAAGGGGTCGGCTCAGTGCCTGG + Intergenic
1163819222 19:19486706-19486728 AAAGTGCTCAGCTCAGGCCTCGG - Intronic
1165095991 19:33410240-33410262 CAGGAGCTCAGCTCAGACCTTGG - Intronic
1165357067 19:35310837-35310859 AAAGGGCTCAGCCCAGGCCCTGG - Intronic
1166140851 19:40804384-40804406 CAAGGCCTCAGCACTGGCCTGGG - Intronic
1166928890 19:46289107-46289129 CAAGGGCTCAGGACAGCGCTTGG + Intergenic
1167001970 19:46750899-46750921 CCAGAGCACAGCTCAGTGCTTGG - Intronic
1167212228 19:48140256-48140278 AAAGGGCTCAGAACAGTCCCAGG + Intronic
1168115705 19:54220474-54220496 CAAAGGCTCAGCTCCGGCCCAGG - Intronic
1168118691 19:54240220-54240242 CAAAGGCTCAGCTCAGGCCCAGG - Intronic
1168250838 19:55141077-55141099 CTAAGGCTCAGCTCTGTACTAGG + Intronic
1168340801 19:55622011-55622033 CAAGGGCTTCACCCAGTCCTCGG - Exonic
927145614 2:20163766-20163788 CAAAGGCTCAGCCCAGTACCTGG + Intergenic
927988668 2:27431470-27431492 CAAGGACTTAGCCCAGTGCTTGG + Intronic
929452357 2:42046549-42046571 CAGGGACTCAGCTCTCTCCTCGG + Intergenic
929574783 2:43044503-43044525 CAAAGGGTCAGCTCAGCCCTGGG + Intergenic
929598759 2:43192031-43192053 CCAGGGCTCAGCACAGTGCCTGG - Intergenic
929746439 2:44664443-44664465 CAGGAGCTAAGCTCAGTGCTGGG + Intronic
930018019 2:46984242-46984264 CAGGGGCTCAGCTCAGTAACAGG - Intronic
930597700 2:53408310-53408332 CAAGTGCTTAACACAGTCCTTGG - Intergenic
932887058 2:75557953-75557975 AAAGGGCTTAGCCCAGTGCTTGG - Intronic
933232478 2:79824979-79825001 CAAGGGTTCAGCACAAACCTTGG + Intronic
936016322 2:108961689-108961711 CTTGGGCTCAGCTCAGCCTTGGG + Intronic
936516654 2:113185429-113185451 TTAGGGCTCACCTCTGTCCTGGG - Exonic
936518033 2:113194423-113194445 CAAGTGCTCAGCACGGTGCTTGG + Intronic
937336205 2:121063926-121063948 CCAGGGCTGAGCTCAGTGCCAGG - Intergenic
937759379 2:125582039-125582061 CAAGGGCTTAGCTAGGTCCTGGG + Intergenic
938022789 2:127919864-127919886 CAAGTGCTCATTTCAGTCTTTGG + Intergenic
938234884 2:129698064-129698086 CATGGGCTGAGCTCTGTGCTAGG + Intergenic
939090276 2:137772336-137772358 GAAGGGCTCAGCACAGTGCCAGG - Intergenic
941222059 2:162794427-162794449 AAAGAACTCAACTCAGTCCTGGG + Intronic
946299129 2:218811825-218811847 CAAGTGCTTAGCTCAGTGCCTGG - Intronic
946299331 2:218813026-218813048 CCAGTGGACAGCTCAGTCCTCGG + Exonic
947430412 2:230023218-230023240 CCAGGGCTTAGCTCAGTGCCTGG - Intergenic
947968579 2:234302737-234302759 CACTGGCCCCGCTCAGTCCTGGG - Intergenic
949030824 2:241796486-241796508 TCAGGGCTCTGCTCAGTCATGGG + Intronic
1169205858 20:3740067-3740089 CAAAGGTCCAGCTCAGTCCCAGG + Intronic
1171010688 20:21507875-21507897 CAAGGGTGCCGCTCAGTCCCGGG - Intergenic
1172063781 20:32205730-32205752 AAAGGGCTCAGCACAGAGCTTGG + Intronic
1172136181 20:32688480-32688502 CACGGGCTCAGATCAGCCCAGGG + Intergenic
1172156553 20:32829760-32829782 CAAAGGCTCAGCTCACTGTTGGG - Intronic
1174186511 20:48709985-48710007 CAAGAGCTCAGCAAAGTCCCAGG - Intronic
1174994473 20:55550591-55550613 CATAGGCTCAGGTCAGGCCTTGG - Intergenic
1175264076 20:57692131-57692153 CAAGGGCTCAGCTCAGTCCTGGG - Intronic
1175439170 20:58978834-58978856 CAAGCTCTCTGCTCAGTGCTTGG + Intergenic
1175884882 20:62284186-62284208 CCAGGGCTCAGCTCTGCCCGGGG - Intronic
1176056823 20:63153183-63153205 CAAGGCCTCAGCTATGTCCCAGG + Intergenic
1176378991 21:6102299-6102321 GAAGGGCTCAGACAAGTCCTGGG + Intergenic
1178668014 21:34565885-34565907 CAAGGGCGGAGCTCACACCTGGG + Intronic
1179604059 21:42501097-42501119 CAAGGACATAGCTCAGTGCTTGG + Intronic
1179744483 21:43435938-43435960 GAAGGGCTCAGACAAGTCCTGGG - Intergenic
1179883614 21:44304127-44304149 CAAGGGCTCAGCACAAAGCTGGG + Intronic
1179994214 21:44966572-44966594 CAAGCCCTCAGGTCTGTCCTGGG + Intronic
1180232286 21:46434397-46434419 GAAGGCCTCAGCTCAGTGCTGGG + Intronic
1181758010 22:25039078-25039100 CAAGAGCCCATCTCAGGCCTCGG - Exonic
1182063575 22:27415242-27415264 CCAGGGCTCAGCTCAGTTCTGGG - Intergenic
1183096694 22:35556246-35556268 AAAAGGCTCAGCACAGTGCTTGG - Intergenic
1183749941 22:39714103-39714125 CAGGGGTTCAGCTGAGGCCTGGG + Intergenic
1183833939 22:40436500-40436522 GAAGGGCTCAGCTCTATTCTGGG + Intronic
1184667432 22:45996415-45996437 CCAGGACTCAGCTCTGTCCCAGG - Intergenic
1184973572 22:48045266-48045288 AAAGCTCTCAGCTCAGTGCTAGG + Intergenic
950006387 3:9694196-9694218 CAAGGGCTTTGGTCAGACCTGGG + Intronic
950214668 3:11150881-11150903 AAAGTGCTCAGCACAGTGCTTGG - Intronic
950405224 3:12800092-12800114 CATGTGCTCACCTCAGGCCTTGG + Intronic
951680621 3:25290787-25290809 TTAGCGCTCTGCTCAGTCCTTGG + Intronic
954704316 3:52471072-52471094 CAGGGGCTCAGCCCAGACTTGGG + Intronic
956799338 3:72742847-72742869 GAACTGCTGAGCTCAGTCCTCGG + Intergenic
958035362 3:88164288-88164310 CACGACCTCAGCTCACTCCTGGG + Intronic
959765224 3:110018880-110018902 CAAGGGCTCTGACAAGTCCTAGG - Intergenic
960530114 3:118754798-118754820 CATGGGCTCAGCTCTGTGCTGGG + Intergenic
961443269 3:126965506-126965528 AAAGGGCTCAGCACAGTACCTGG - Intergenic
961547181 3:127642973-127642995 CGAGCACTCAGCTCAGTGCTTGG + Intronic
962290584 3:134133373-134133395 GAAGGGCTCATCTCAGTGCCTGG - Intronic
962922502 3:139963850-139963872 CAAGAACTCAGCTCAGCACTGGG - Intronic
964871596 3:161319236-161319258 CCTGGGCTCAGTTCAGTCCTAGG - Intergenic
964944521 3:162203605-162203627 CAAGAGCTAAGCTCTTTCCTAGG - Intergenic
966429259 3:179814293-179814315 AAAGTGCTCAGCTCAGTGCCTGG - Intronic
967257069 3:187604157-187604179 CAAGAGCCCAGCGCAGTACTAGG - Intergenic
968622782 4:1611217-1611239 CTCTTGCTCAGCTCAGTCCTTGG + Intergenic
968654809 4:1773847-1773869 CAGGTGCTCAGCTCTGGCCTGGG + Intergenic
968950354 4:3688373-3688395 CAAGGGATCAGGGCAGTCCTGGG + Intergenic
969060371 4:4429200-4429222 GAAGGGCTCAGAGCAGTACTTGG + Intronic
969525657 4:7702696-7702718 ACAGAGCTCAGCTCAGACCTTGG - Intronic
969642594 4:8407958-8407980 GAAGTGCTCAGCCCAGCCCTGGG + Intronic
969664955 4:8552110-8552132 CAAGGAAGCAGCTCAGGCCTGGG + Intergenic
970144107 4:13014657-13014679 CAATGACTGAGCTCAGTCCTGGG - Intergenic
970782582 4:19756367-19756389 CCAGGTCTCAGCACAGTCCCTGG + Intergenic
971188335 4:24402578-24402600 CCAGGGCTCAGCCCAGAGCTGGG + Intergenic
973222033 4:47737564-47737586 CAAAGCCTCAGCTAAATCCTTGG - Intronic
974404933 4:61454106-61454128 AAAGGGCTCAGCACAGTGCGTGG + Intronic
976642957 4:87358339-87358361 CCAGGGCCCAGCACAGTGCTTGG + Intronic
976872583 4:89813088-89813110 CATGGGCTCAGATTAGGCCTCGG + Intronic
981669786 4:147274530-147274552 CAATGGCCTACCTCAGTCCTGGG + Intergenic
985220681 4:187700673-187700695 AAAGGGCTTAGCACAGTGCTTGG + Intergenic
986417593 5:7544659-7544681 CCATGGCTCAGCTCACCCCTGGG + Intronic
988788090 5:34582550-34582572 CAAAGACTTAGCTCAGCCCTTGG + Intergenic
989638399 5:43559507-43559529 CAAGGGCTCAGATCCATCTTGGG + Intergenic
990013733 5:51031885-51031907 CAAGGGCTCAATTCAGCCCAAGG + Intergenic
991604355 5:68385303-68385325 CAAGGAATCAGCTCAGTCCAGGG - Intergenic
992093341 5:73338906-73338928 CAAGGCCTCCGCTCAGTTCAGGG - Intergenic
992403442 5:76432663-76432685 CCAGAGCACAGCTCAGTCCCTGG - Intronic
994196191 5:96925412-96925434 CAGGCTCTCACCTCAGTCCTGGG + Intronic
994466518 5:100140082-100140104 CAAGGCCTCACCTCAGGCTTAGG - Intergenic
994819521 5:104631776-104631798 CAATGGCTTAGCACAGTGCTAGG - Intergenic
996218021 5:120892372-120892394 CATGGTCTCAGCTCAATTCTGGG + Intergenic
997353333 5:133246453-133246475 CAAGGACCCAGCTCAGTGCCTGG - Intronic
997386703 5:133479246-133479268 CCAGGGCTGAGCCCAGTGCTGGG + Intronic
998627487 5:143862048-143862070 CAAGAGCTCTGCTCAGTGCTGGG - Intergenic
998902926 5:146875228-146875250 AAAGAGCTCAGCACAGTGCTTGG + Intronic
999054219 5:148556491-148556513 CTAGTACTCAGCACAGTCCTTGG - Intronic
999311836 5:150556457-150556479 CATGGGCACAGCTCTGTGCTGGG - Exonic
1000281468 5:159786160-159786182 CAAGGGCTCTTCTCACACCTGGG + Intergenic
1003871763 6:10409947-10409969 CACGCGCTCAGCTCAGGACTCGG - Exonic
1004549676 6:16634829-16634851 AGAGTGCTCAGCTCAGTACTTGG + Intronic
1005506383 6:26472467-26472489 CAAGGTTTCAGCTAAGTCCTAGG + Intronic
1008526361 6:52411314-52411336 AAACAGCTCAGCTCAGTTCTTGG - Intergenic
1009194574 6:60668594-60668616 CATGTGCTCAGCTTGGTCCTGGG + Intergenic
1010873079 6:81065427-81065449 CACGGTCTCAGCTCACTCCTGGG + Intergenic
1011218304 6:85028894-85028916 CTAGAGCTCAGCTCAGTGCCTGG + Intergenic
1013472457 6:110476972-110476994 CAAGGGCTAGGCTCGGTCCGGGG + Intergenic
1013726578 6:113105057-113105079 CATGGACTCACCTCAGTTCTTGG + Intergenic
1013812810 6:114063797-114063819 CATGTCCTCTGCTCAGTCCTGGG + Intronic
1015706087 6:136089133-136089155 TAAGGTCCCACCTCAGTCCTAGG + Intronic
1016514490 6:144879262-144879284 AGAGGACTCAGCTCAGTCCATGG - Intergenic
1016995950 6:149962674-149962696 CAGGAGCTCAGGTTAGTCCTAGG - Intergenic
1017812533 6:157994476-157994498 CAAGGGCCTGGCTCAGGCCTGGG - Intronic
1018682713 6:166277201-166277223 CCAGGGCTCTGTTCTGTCCTTGG + Intergenic
1018904107 6:168065147-168065169 CAGGGGCTCAGGACAGCCCTGGG - Intronic
1022537523 7:31107162-31107184 CTGGGGCTCTTCTCAGTCCTGGG + Exonic
1029563370 7:101318945-101318967 TCAGGGCTCACCTCACTCCTTGG + Exonic
1032469018 7:132164633-132164655 CAAAGGCAGAGGTCAGTCCTGGG + Intronic
1033285463 7:140037403-140037425 CAGGGACTCAGGTTAGTCCTCGG + Intronic
1033466031 7:141590512-141590534 CTAGGGGTCAGCACAGTCCAGGG + Intronic
1033937847 7:146610252-146610274 CCAGGGCTCTGCTCTCTCCTAGG - Intronic
1037748721 8:21666235-21666257 CAAGGTCTCAGCACAGCCCGTGG - Intergenic
1041168402 8:55114996-55115018 CAAGCCCACAGCTCTGTCCTTGG - Intronic
1041479997 8:58309187-58309209 CAAGGGCTCTGACAAGTCCTAGG + Intergenic
1042226619 8:66519687-66519709 CAAGGGGCCAGCCCAGGCCTGGG - Intergenic
1043425600 8:80145491-80145513 CCAGGACTCAGCTCAGTGCTGGG + Intronic
1045357485 8:101402572-101402594 CCAGGGCTCAGCCCAGACCAGGG - Intergenic
1046211441 8:111081454-111081476 TCTGGGCTCAGCTCAGCCCTGGG + Intergenic
1047180201 8:122580250-122580272 CAAGGGCTCAGGTTAATTCTAGG + Intergenic
1047833161 8:128658210-128658232 CAAGTGCTGAGCTCAGTACAGGG + Intergenic
1048270279 8:133022710-133022732 CCAGGGCTCACTTCAGCCCTAGG - Intronic
1050253793 9:3773138-3773160 CAAGTGGTCAGATCAGTGCTGGG + Intergenic
1051704244 9:19860046-19860068 TCTGGGCTCAGTTCAGTCCTAGG - Intergenic
1052411352 9:28125733-28125755 CATGGGCTCAGCTCACCCTTTGG - Intronic
1052901229 9:33796415-33796437 CAGGGGCTCAGATCTCTCCTGGG - Intronic
1054458512 9:65449591-65449613 CCAGGGGTGAGCCCAGTCCTGGG + Intergenic
1055405511 9:75969710-75969732 CAAATACTCAGCACAGTCCTTGG - Intronic
1057386155 9:94607405-94607427 CAAGTGCTCAGCGCTGTTCTCGG + Intronic
1057806868 9:98225709-98225731 GGAAGGCTCAGCACAGTCCTGGG + Intronic
1060412502 9:123409143-123409165 CAAGTGCCTAGCACAGTCCTAGG + Intronic
1060549619 9:124478747-124478769 AAAGGGCTCAGCACCGTCCAGGG - Intergenic
1060740551 9:126095227-126095249 CAAGGGCTTAACATAGTCCTGGG + Intergenic
1061265322 9:129501473-129501495 CAAGGGCTCATCCCAGTCCCGGG - Intergenic
1061277895 9:129579967-129579989 GAAGAGCTCAGCTCAGGGCTGGG - Intergenic
1061360803 9:130141115-130141137 CAAGGGCTTGGCCCAGTGCTGGG + Intergenic
1061594590 9:131620754-131620776 CTGGGGCTCAGCCCAGTCCCAGG - Intronic
1061667199 9:132167514-132167536 CAAAGGGCCAGCTCAGTGCTTGG - Intronic
1062046064 9:134425084-134425106 CAAGGTCTCTGCTCACTCCGGGG + Intronic
1062070531 9:134552903-134552925 CAAAGGCCCAGCCCTGTCCTGGG - Intergenic
1186195452 X:7106976-7106998 CAAGGACTCTGCCCAGGCCTTGG - Intronic
1187731225 X:22256968-22256990 CAAGGGCTAAGCTCGCTCCTTGG + Intergenic
1188908668 X:35819501-35819523 CAAGTGCTTTGCTCAGTCCTTGG - Intergenic
1189720569 X:43911800-43911822 AAAGGGCTTAGCACATTCCTTGG - Intergenic
1189867671 X:45348308-45348330 CCAGGGCTGAGCACAGTGCTTGG - Intergenic
1195162362 X:102183180-102183202 CAAGGGTTCAGTTCCATCCTTGG - Intergenic
1195166402 X:102224777-102224799 CAAGGGTTCAGTTCCATCCTTGG - Intronic
1195192458 X:102462311-102462333 CAAGGGTTCAGTTCCATCCTTGG + Intronic
1196481783 X:116158622-116158644 CAAGTGCCCAGCACAGTACTTGG + Intergenic
1198506909 X:137310018-137310040 CAAGGGCTTAGCCCAGTACCTGG + Intergenic
1198523356 X:137474619-137474641 TCAGGGCTCAGCACAGTGCTTGG + Intergenic
1198553045 X:137764252-137764274 CCCTGGCTCAGCACAGTCCTTGG - Intergenic
1198610566 X:138395320-138395342 GAAGGTCTCAGCTGATTCCTTGG - Intergenic
1199540646 X:148954513-148954535 CAAGAGCTCAGCACAGTGCCTGG - Intronic
1199751959 X:150828312-150828334 GAAGCACTCAGCACAGTCCTTGG - Intronic
1199767621 X:150952583-150952605 CCAGGGCTCAGCTCAGTGCCTGG + Intergenic