ID: 1175264077

View in Genome Browser
Species Human (GRCh38)
Location 20:57692132-57692154
Sequence GCAAGGGCTCAGCTCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264077_1175264081 22 Left 1175264077 20:57692132-57692154 CCAGGACTGAGCTGAGCCCTTGC 0: 1
1: 0
2: 2
3: 29
4: 241
Right 1175264081 20:57692177-57692199 TTACGATGCCCCCTGTGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1175264077_1175264082 23 Left 1175264077 20:57692132-57692154 CCAGGACTGAGCTGAGCCCTTGC 0: 1
1: 0
2: 2
3: 29
4: 241
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264077 Original CRISPR GCAAGGGCTCAGCTCAGTCC TGG (reversed) Intronic
900471550 1:2857504-2857526 TCCAGGGCTGAGCTCAGTGCTGG + Intergenic
900621381 1:3589049-3589071 GCAGGGCCTCATCTCAGTCGTGG - Intronic
900643665 1:3699006-3699028 GCAAGGCCTCGCCTCAGCCCCGG + Intronic
900707042 1:4087269-4087291 GCAGGTGCTCAGCTCTGTGCTGG + Intergenic
900815899 1:4845534-4845556 GAAAGGGCCCATCTGAGTCCTGG + Intergenic
901648174 1:10727778-10727800 GCAAGGGCTGAGGGCAGCCCTGG - Intronic
903016393 1:20364862-20364884 GCAAAGGCACAGCTCACTACAGG + Intergenic
903288027 1:22289229-22289251 GGAAGCGCTCAGCACAGTCTTGG + Intergenic
903438206 1:23368321-23368343 GGAGGTGCTCAGCTCAGCCCAGG + Intronic
903660836 1:24977434-24977456 GCATGAGCTCAGCTCATTGCAGG - Intergenic
904266386 1:29320621-29320643 GCAGAGGCTCAGCCCAGGCCAGG + Intronic
904490299 1:30854524-30854546 GTAAAGACTCAGCTCAGGCCGGG + Intergenic
904750075 1:32736373-32736395 GCAAGATCTCAGCTCACTGCAGG - Intergenic
904890932 1:33778973-33778995 GCAAGGGCTGAACTCAGGCAGGG - Intronic
907238816 1:53069496-53069518 GCAAGGGTTCAGCACAGTCCAGG + Intronic
909608759 1:77532065-77532087 GCAAGCGCTGCGCACAGTCCCGG + Intronic
912800419 1:112716397-112716419 GCCAGGGCTGAGAGCAGTCCGGG + Intergenic
913344467 1:117794246-117794268 TTAAGAGCTCAGCTCACTCCCGG + Intergenic
914940267 1:152016555-152016577 GGAAGGGCACACCTCTGTCCTGG + Intergenic
915148150 1:153807724-153807746 GAAAGGACTCAGCTCAGGGCAGG + Exonic
915211532 1:154313210-154313232 CCAAAGGCTTATCTCAGTCCGGG - Intergenic
919102730 1:193113611-193113633 GCAAGGTCTCAGCTGAATCTTGG - Intergenic
920364314 1:205440108-205440130 GGGAGGGCACGGCTCAGTCCAGG + Intronic
921479980 1:215653043-215653065 GCAAGTGCTCAGCACAGTTCTGG + Intronic
922750057 1:228066067-228066089 GCACATCCTCAGCTCAGTCCAGG - Intergenic
923462855 1:234222256-234222278 GACATGGCTCAGCTCATTCCTGG - Intronic
1062874582 10:932832-932854 CCAAGGCCTCGGCTCAGCCCCGG + Intergenic
1065557357 10:26930306-26930328 GCAAGATCTCAGCTCACTGCAGG + Intergenic
1067060078 10:43073755-43073777 TCAAGAGCGCAGCTCGGTCCTGG - Intergenic
1067561107 10:47305238-47305260 GCAAGGGCTCAGAACAGTTATGG - Intronic
1069080977 10:64087914-64087936 ACAAGGGCCCAGATCAGTCTTGG - Intergenic
1069571172 10:69495246-69495268 GCCAGGTCTCAGCTCAGGCATGG + Intronic
1069981279 10:72254584-72254606 GCAAAGGATCACTTCAGTCCAGG + Intergenic
1071177425 10:82942637-82942659 GCAAGGGCAAGGCTCAGGCCAGG - Intronic
1072725675 10:97811877-97811899 GTCAGGGCTCAGCTCTGACCTGG + Intergenic
1074703985 10:116115423-116115445 GCATGGGCTCATCTCACCCCAGG - Intronic
1074842983 10:117374257-117374279 GCAAAGGCTCATTTCTGTCCTGG - Intronic
1075170047 10:120104724-120104746 CCATGGGCTCAGCTCTGTGCTGG - Intergenic
1075322459 10:121503017-121503039 CCAAGAACTCTGCTCAGTCCTGG + Intronic
1075604349 10:123793504-123793526 GCTTTGGCTCAGCTCAGACCTGG - Intronic
1076414482 10:130275793-130275815 GACAGAGCTCAGGTCAGTCCAGG - Intergenic
1076895356 10:133308811-133308833 GCCAGGACTCACCGCAGTCCCGG + Exonic
1077106924 11:846188-846210 GCAGGGCAGCAGCTCAGTCCTGG - Intronic
1077199801 11:1300700-1300722 GGAAGAGCCCAGCTCAGCCCAGG + Intronic
1077224685 11:1434890-1434912 TCAAGGCCACAGCTCAGGCCAGG + Intronic
1077233613 11:1469543-1469565 GCAGGGCCTCAGCCCCGTCCTGG + Intronic
1077366177 11:2162260-2162282 GCACTGGCCCAGCTCCGTCCTGG + Intergenic
1077482553 11:2822742-2822764 GCAGGGGCTCAGCTCAGAACAGG + Intronic
1080745125 11:35101937-35101959 GAAGGGGCTCAGCACATTCCAGG - Intergenic
1081245731 11:40764238-40764260 GGAAGGGCCCAACCCAGTCCTGG + Intronic
1081580288 11:44347204-44347226 GCTAGGCCTCTGCTCAGCCCTGG + Intergenic
1081580851 11:44350639-44350661 GCCTGGGCTCAGCCCAGCCCTGG + Intergenic
1081743707 11:45458424-45458446 GCTAGGGCTCAGCTGTGGCCTGG - Intergenic
1083399487 11:62413915-62413937 GCAAGGGGTGAGCTCAGAGCAGG + Intronic
1083474534 11:62907349-62907371 GCAAGGGCTTAGCTCCACCCAGG + Intergenic
1083896826 11:65624272-65624294 GGAAGGGCTGAGCTGAGCCCAGG - Exonic
1084316714 11:68349863-68349885 GCCAGGGCTTAGCACAGCCCAGG - Intronic
1084480254 11:69415908-69415930 GGAAGGGCTCAGCTCAGCCTAGG - Intergenic
1085465610 11:76721485-76721507 GCAAGGGCTCCCTTCTGTCCTGG - Intergenic
1085534877 11:77211782-77211804 GTCAGGGCTGGGCTCAGTCCTGG - Intronic
1087882715 11:103437441-103437463 ACAATTGCTCAGATCAGTCCTGG - Intronic
1090395192 11:126414183-126414205 GCATGGCCTCATCTCAGACCTGG - Exonic
1090411437 11:126512444-126512466 GCAAGAGCCCACCTCTGTCCTGG - Intronic
1090927449 11:131261024-131261046 GCAAGGTGGCAGCTCAGTCAGGG - Intergenic
1093376181 12:18430578-18430600 GCATGTGCACAGCTGAGTCCAGG - Intronic
1093711462 12:22334221-22334243 GCAGGGGCTCATCGCAGCCCCGG + Exonic
1096563293 12:52452184-52452206 GCATGGGCTGGGCCCAGTCCTGG + Intergenic
1096565445 12:52473847-52473869 GCATGGGCTGGGCCCAGTCCTGG + Intergenic
1096567464 12:52493295-52493317 GCATGGGCTGGGCCCAGTCCTGG + Intergenic
1096950920 12:55470181-55470203 GCAAGGGTTGAGCTAGGTCCAGG + Intergenic
1097638693 12:62152849-62152871 GCAAGGGCTCAACACATTCGTGG - Intronic
1100142306 12:91633963-91633985 GCAAGGGCTACGCGCAGCCCCGG - Intergenic
1102518753 12:113466417-113466439 GCAAGGGGACAGCTCACCCCAGG + Intronic
1102733817 12:115139307-115139329 GCAACTACTCAGCTCAATCCTGG - Intergenic
1103739920 12:123084158-123084180 AGAAGGGCTCAGCTCACCCCAGG + Intronic
1104508404 12:129354098-129354120 ACAAGGGTCCAGCTCAGCCCAGG + Intronic
1105541248 13:21319373-21319395 GCAACGGCTCAGCTCCGGCCTGG - Intergenic
1106110105 13:26769621-26769643 GCCATGGCTCAGATTAGTCCGGG + Intergenic
1107670474 13:42741696-42741718 GCAAGTTCTGAGCTCAGTTCTGG + Intergenic
1110554193 13:76840120-76840142 GGAAGGGCACAGCTCAGTTCTGG - Intergenic
1112091103 13:96085098-96085120 GAAAGGGCTTAGCTCACTGCAGG + Intergenic
1113884557 13:113651839-113651861 CCAAGGGCCCTTCTCAGTCCTGG - Intronic
1116973387 14:51092510-51092532 GCAAGGCCACAGCTGAGGCCTGG + Intronic
1118317402 14:64733598-64733620 GGATGGGCCCAGCCCAGTCCTGG + Intronic
1119323345 14:73744423-73744445 GCGGGGGCTCAGCTCTGACCTGG + Intronic
1119720078 14:76884598-76884620 GCATGGGCCCAGCTGACTCCTGG + Intergenic
1121097595 14:91228648-91228670 GCAGGGGCTGTGCTCAGTGCTGG + Intergenic
1121250029 14:92492621-92492643 TCAAGTGCTCAGCACAGACCTGG - Intronic
1121487151 14:94326012-94326034 GCACGTGCTCAGCTCACTGCAGG + Intergenic
1121845848 14:97171403-97171425 GCAAGGGCTTAGCACGCTCCGGG - Intergenic
1122027609 14:98888887-98888909 GCAAGGGAACAGCGAAGTCCAGG + Intergenic
1122121063 14:99553778-99553800 GCAGGGGCTCAGCCCAGCCCTGG - Intronic
1123065456 14:105616801-105616823 GCAGGGGCTCAGCTGAAACCTGG + Intergenic
1123094682 14:105761307-105761329 GCAGGGGCTCAGCTGAAACCTGG + Intergenic
1123449533 15:20351254-20351276 GCAAGGTCTAGGCTCACTCCAGG + Intergenic
1124504556 15:30261779-30261801 GCCAGGTCTCAGCTCAGCCTGGG + Intergenic
1124605787 15:31169566-31169588 TCAGGGGCTCAGCTCTGGCCTGG - Intergenic
1124626127 15:31308466-31308488 GCAAGGGCTCAGCTCCTCCTGGG - Intergenic
1127960636 15:63887864-63887886 ACAAGGGCTGAGCTCAGAGCAGG - Intergenic
1128579459 15:68798701-68798723 GCAGGGGCTGAGCTCAGGTCTGG - Intronic
1130768846 15:86903788-86903810 GAAAGGGATCAGCAAAGTCCTGG - Intronic
1131386392 15:92011715-92011737 GCAAGGGCTCAGCTTTGCCAAGG + Intronic
1132576737 16:667869-667891 GCAGAGGCTGAGCTCAGGCCAGG - Intronic
1132755382 16:1481997-1482019 GGGAGGGCTCAGCTCACTCCAGG - Intergenic
1137521709 16:49200627-49200649 GCATGGACTCAGCACAGCCCTGG + Intergenic
1137614385 16:49838238-49838260 GCAGGGGCTGAGCACAGTTCTGG + Intronic
1138051570 16:53783996-53784018 CCAAGGGCCCATCTCAGCCCTGG - Intronic
1138270028 16:55689379-55689401 TCAGGGTCTCAGCTCAGTCATGG + Intronic
1139296960 16:65909602-65909624 ATCAGGGCTCAGCTAAGTCCAGG + Intergenic
1140465120 16:75175147-75175169 GCAAGGCTTCAGGTCTGTCCTGG + Intergenic
1141575165 16:84958953-84958975 GGAAGGGGTCAGGTCAGACCGGG + Intergenic
1141707871 16:85678675-85678697 GCAAGGGCTAAAGTCAGTCGGGG + Intronic
1143107828 17:4538274-4538296 GAAAAGGCTCAGCTCAGCCTCGG - Exonic
1143353727 17:6308795-6308817 CCAAGGGCTCTGCTCAGGCCAGG - Intergenic
1144183645 17:12775493-12775515 GAAAGGGCTCTGCTAGGTCCAGG + Intergenic
1144847359 17:18226789-18226811 GCAGGGCCTCAGCCCACTCCTGG + Intronic
1145052498 17:19673869-19673891 GCAATGGCTTAGCTGCGTCCAGG + Intronic
1145290842 17:21544597-21544619 GCTACGGCTCAGCTCAGCCATGG + Intronic
1148456436 17:47813890-47813912 GCAAGCCCACAGCCCAGTCCAGG + Intronic
1150083644 17:62262697-62262719 GTCAGTGCTCAGGTCAGTCCGGG - Intergenic
1150656460 17:67042925-67042947 GCGAGGGTTCAGCTCAGCCCTGG + Intergenic
1151576682 17:74955963-74955985 GGGAGGGGTCAGCTCACTCCTGG + Intronic
1152554157 17:81044833-81044855 GCAAGGCGCCAGCTCAGTGCTGG + Intronic
1152669412 17:81593337-81593359 GCAAGGGCTGAGCACAGGGCTGG - Intronic
1154302668 18:13207975-13207997 CCCAGGTCTCAGCTCAGTGCGGG + Intergenic
1157177371 18:45463909-45463931 GAAAAGGCTCAAATCAGTCCAGG + Intronic
1160007318 18:75076874-75076896 TCCAGGGCCCAGCTCAGGCCTGG + Intergenic
1160784911 19:895707-895729 GCACGGTCTCAGCTCACTGCAGG + Intergenic
1161162442 19:2768773-2768795 GGGAGGGCTCAGCTCGGCCCTGG + Intronic
1161310686 19:3592503-3592525 GCAAGAATTCAGCTCAGCCCTGG + Exonic
1161812284 19:6477553-6477575 CCAAGGGCTCAGGTCAGTCCTGG + Intronic
1161864976 19:6826974-6826996 GCTAGGGCTCAGCCCAGGGCTGG - Intronic
1162563923 19:11434873-11434895 GCAAGGGCACAGCCCAGGCGTGG - Exonic
1162761400 19:12890887-12890909 GAAAGGGCTCGGCCCACTCCTGG - Intergenic
1163621949 19:18366217-18366239 GCAGGTGCTTAGCTCAGTTCAGG - Exonic
1163849424 19:19654923-19654945 ACGGGGGCTCAGCTCAGGCCTGG - Intronic
1164720978 19:30431330-30431352 CCAAGGGCCCAGCCCAGCCCTGG + Intronic
1165755528 19:38290624-38290646 GGCAGGGCTGAGCTCAGTCAAGG - Intronic
1166405458 19:42518793-42518815 TTAAGAGCTCAGCTCAGGCCGGG - Intronic
1167467876 19:49659640-49659662 GCGAGGGCTCAGCTCTCCCCAGG + Exonic
1167668341 19:50835930-50835952 GGAAGCGCTCAGCACAGACCTGG - Intronic
1168317718 19:55491297-55491319 GCTAGTGCTCAGCCCTGTCCCGG + Intronic
925168197 2:1732331-1732353 CTCAGGGCTCAGCTCAGTGCTGG - Intronic
925230938 2:2233350-2233372 GCCACGTCTCATCTCAGTCCTGG + Intronic
927022855 2:19035481-19035503 GGAAGGGCCCAGCTCAGACAGGG - Intergenic
928203867 2:29270362-29270384 CCAAGAGCTCAGCACAGTCCTGG + Intronic
929023783 2:37579327-37579349 GCAGAGGCCCAGCTAAGTCCAGG - Intergenic
929574782 2:43044502-43044524 CCAAAGGGTCAGCTCAGCCCTGG + Intergenic
934323429 2:91985924-91985946 GCAAGGGCTGGGCTCAGGCTGGG - Intergenic
935707903 2:105872289-105872311 GCAAGGGCACAGGGCAGGCCTGG - Intronic
936249946 2:110860545-110860567 GCAATGTCTCAGCCCAGGCCAGG - Intronic
937243151 2:120475453-120475475 GCAAGGGTTCAGCCCAGGCTGGG + Intergenic
937568122 2:123321408-123321430 GCAATAACTCAGCTGAGTCCTGG + Intergenic
937759378 2:125582038-125582060 GCAAGGGCTTAGCTAGGTCCTGG + Intergenic
938420779 2:131144707-131144729 GCAAGGACTGAGCTCAATGCAGG + Intronic
943203558 2:184860848-184860870 GCAATGGCCAAGCTCAGTGCTGG + Intronic
947983551 2:234429563-234429585 GCAAGAGCACAGCTAAGTGCAGG - Intergenic
948332931 2:237184302-237184324 GCATGCTCTCAGCTCGGTCCAGG + Intergenic
948595596 2:239077323-239077345 GCAAGCCCCCAGCTGAGTCCTGG - Intronic
1169112800 20:3044519-3044541 GCGAGCCCTCAGCTCAGCCCAGG + Exonic
1169974975 20:11314305-11314327 GCAAGGGCTTAGCCAAGACCTGG - Intergenic
1171010689 20:21507876-21507898 CCAAGGGTGCCGCTCAGTCCCGG - Intergenic
1172136180 20:32688479-32688501 CCACGGGCTCAGATCAGCCCAGG + Intergenic
1172156554 20:32829761-32829783 GCAAAGGCTCAGCTCACTGTTGG - Intronic
1173634492 20:44543212-44543234 TAAAGGGCTCAGCACAGTCTTGG + Intronic
1175244451 20:57573196-57573218 CCAAGGGCTAGGCTCAGCCCAGG - Intergenic
1175264077 20:57692132-57692154 GCAAGGGCTCAGCTCAGTCCTGG - Intronic
1175884884 20:62284187-62284209 CCCAGGGCTCAGCTCTGCCCGGG - Intronic
1175905262 20:62376516-62376538 GCAGGGGCTCAGTGCATTCCTGG - Intergenic
1176268706 20:64224158-64224180 CCAAGGCCTCAGCTCGGCCCCGG - Intronic
1177024484 21:15905310-15905332 GTAAGGGCTTAGGTCTGTCCTGG - Intergenic
1178668013 21:34565884-34565906 GCAAGGGCGGAGCTCACACCTGG + Intronic
1178853648 21:36233301-36233323 GCAGGGGTTCCACTCAGTCCTGG - Intronic
1179615758 21:42582253-42582275 GCAGGGGCTCAGGGCAGCCCAGG - Intergenic
1180037487 21:45257272-45257294 GCAAGGGCTCTGCTCCCACCCGG - Intergenic
1180184759 21:46134039-46134061 GCCAGGGCTCAGCCTATTCCAGG + Intergenic
1180232285 21:46434396-46434418 GGAAGGCCTCAGCTCAGTGCTGG + Intronic
1181077696 22:20392698-20392720 GCAAGCGCTGCGCGCAGTCCCGG + Intergenic
1181855733 22:25780255-25780277 GCGTGGGCTCTGCTGAGTCCCGG - Intronic
1182063577 22:27415243-27415265 CCCAGGGCTCAGCTCAGTTCTGG - Intergenic
1182090022 22:27588191-27588213 GCCAGGCCTCAGATCAGTCTTGG - Intergenic
1182294676 22:29306158-29306180 TCAAGGGCGCAGAGCAGTCCTGG + Intergenic
1182780311 22:32862323-32862345 GCCAGTGCTCTGCTCTGTCCAGG + Exonic
1184842659 22:47061462-47061484 GCAAGGGCTCTGCCAAGTGCTGG - Intronic
950006386 3:9694195-9694217 GCAAGGGCTTTGGTCAGACCTGG + Intronic
953025265 3:39141509-39141531 ACAAGGCCTCAGCTCAGTGTGGG + Intergenic
954671918 3:52295648-52295670 GCAAGGGCTCAGCCAGATCCAGG + Intergenic
954983683 3:54769993-54770015 GCAAGGGCTCTCCTCAGTAAGGG - Intronic
955884343 3:63581717-63581739 GCAAGGGCACCACTCACTCCAGG + Intronic
956132505 3:66067727-66067749 GCAAGTGCTCAGGGCAGACCTGG - Intergenic
960530113 3:118754797-118754819 GCATGGGCTCAGCTCTGTGCTGG + Intergenic
960640233 3:119816409-119816431 ACAACGACTCTGCTCAGTCCTGG + Intronic
963300561 3:143592786-143592808 ACCAGGGCTCAGCTCTCTCCAGG + Intronic
963486851 3:145945467-145945489 GTAATAGCTCAGCTCTGTCCTGG - Intergenic
967915922 3:194578158-194578180 GCAAGGCCTAGGCTCAGTCCTGG - Intergenic
968063804 3:195747181-195747203 GCAAGGCCTCAGCTGAGTTCAGG + Exonic
968382462 4:107992-108014 GCCAGCCCTCAGCTCGGTCCCGG + Intergenic
968480243 4:830064-830086 GCAAGAGATCAGCTCAGAGCGGG - Intergenic
968654808 4:1773846-1773868 GCAGGTGCTCAGCTCTGGCCTGG + Intergenic
968690749 4:1988564-1988586 GCCAGGGCCCAGCGCTGTCCGGG - Intronic
968950353 4:3688372-3688394 GCAAGGGATCAGGGCAGTCCTGG + Intergenic
969602608 4:8185838-8185860 GCAAAGGGTCAGCACAGTCGTGG + Intronic
969671344 4:8592025-8592047 GGAAGGACCCAGCTGAGTCCAGG + Intronic
970144108 4:13014658-13014680 ACAATGACTGAGCTCAGTCCTGG - Intergenic
971188333 4:24402577-24402599 GCCAGGGCTCAGCCCAGAGCTGG + Intergenic
971362928 4:25953463-25953485 GCAAGTGCTCAGCACAGCACTGG - Intergenic
975055372 4:69923911-69923933 GCAAGCGCCCAGCGCAGCCCCGG - Intergenic
978399303 4:108314069-108314091 GCAAAGGCTGAGATCAGTCCTGG + Intergenic
981669785 4:147274529-147274551 GCAATGGCCTACCTCAGTCCTGG + Intergenic
981698164 4:147579944-147579966 ACAAGGGCTCACCTTAGTTCTGG + Intergenic
985080188 4:186256886-186256908 GCAAGGTCTCTGGTCAGCCCAGG + Intronic
985084308 4:186297423-186297445 GCAAGGGCCCAGCGCCGTCCTGG - Intergenic
985848452 5:2371348-2371370 ACCATGGCTCAGCGCAGTCCCGG - Intergenic
986290329 5:6394683-6394705 GCAAAGGCTCTGCTCAGCCATGG + Intergenic
986417591 5:7544658-7544680 GCCATGGCTCAGCTCACCCCTGG + Intronic
987751035 5:22038787-22038809 GCAACTCCTCAGCTCAGTCGAGG - Intronic
988705804 5:33724980-33725002 GAAATGGCCCAGCTCAGGCCCGG + Intronic
989638398 5:43559506-43559528 GCAAGGGCTCAGATCCATCTTGG + Intergenic
991187771 5:63830561-63830583 GAAAGGGATCAGATCATTCCAGG - Intergenic
991427069 5:66503310-66503332 GCAAGCGCTGAGCACAGCCCCGG - Intergenic
991604356 5:68385304-68385326 CCAAGGAATCAGCTCAGTCCAGG - Intergenic
992093342 5:73338907-73338929 ACAAGGCCTCCGCTCAGTTCAGG - Intergenic
994669720 5:102752087-102752109 GCAAGCGCCCTGCTCAGCCCTGG - Intergenic
996154716 5:120083871-120083893 GGAAGGAATCAGCTCTGTCCTGG + Intergenic
997349075 5:133217260-133217282 ACAAGGACTCTGCTCAGTGCTGG + Exonic
998386173 5:141758315-141758337 TCATTGGCTCAGCTCAGCCCAGG - Intergenic
998627488 5:143862049-143862071 CCAAGAGCTCTGCTCAGTGCTGG - Intergenic
999119970 5:149201593-149201615 GAAAGGGCTCCGCACATTCCAGG - Intronic
1000281467 5:159786159-159786181 GCAAGGGCTCTTCTCACACCTGG + Intergenic
1001303542 5:170555168-170555190 GTAATGGCTGAGCTCAGTCTCGG - Intronic
1003407903 6:5838595-5838617 GCCAGGGCTCAGATCTGTTCAGG + Intergenic
1007097181 6:39220539-39220561 AGCAGGGCTCTGCTCAGTCCTGG - Intronic
1007706702 6:43795522-43795544 GGAAGGGCTCAGCTCGATGCTGG + Intergenic
1008184619 6:48373603-48373625 GAAAGGGCTCAACTCAGTAATGG + Intergenic
1010873078 6:81065426-81065448 GCACGGTCTCAGCTCACTCCTGG + Intergenic
1013472456 6:110476971-110476993 GCAAGGGCTAGGCTCGGTCCGGG + Intergenic
1023089279 7:36602844-36602866 ACAAGAGCCCAGGTCAGTCCTGG - Intronic
1026427449 7:70310627-70310649 GAAAGAAGTCAGCTCAGTCCAGG + Intronic
1026867336 7:73831873-73831895 GCCTGCGCTGAGCTCAGTCCAGG - Exonic
1027819327 7:83024077-83024099 GAAAAGGCTCAGCTCACTCAAGG + Intronic
1028122686 7:87073868-87073890 GTAAGGGCTCAGCACAGTGCTGG - Intergenic
1033466030 7:141590511-141590533 ACTAGGGGTCAGCACAGTCCAGG + Intronic
1033597314 7:142866958-142866980 GCCAGGGCTCAGCTGTGTCACGG - Exonic
1036800770 8:11789333-11789355 GCCACTGCTCAGCTCAGTGCCGG - Intergenic
1039476800 8:37843057-37843079 GCAGGGCCTCAGCTTTGTCCCGG - Exonic
1041149201 8:54913871-54913893 GCTGGGGCTGAGCACAGTCCCGG - Intergenic
1043425598 8:80145490-80145512 TCCAGGACTCAGCTCAGTGCTGG + Intronic
1045357487 8:101402573-101402595 GCCAGGGCTCAGCCCAGACCAGG - Intergenic
1045673872 8:104588264-104588286 GCAAGGGCTCTGCCGAATCCGGG - Intronic
1047100208 8:121667753-121667775 GCAAGCGCTGCGCGCAGTCCCGG + Intergenic
1047833160 8:128658209-128658231 CCAAGTGCTGAGCTCAGTACAGG + Intergenic
1049524914 8:143119451-143119473 GCAAGAACTCAGCTCTGTCCTGG + Intergenic
1052901230 9:33796416-33796438 GCAGGGGCTCAGATCTCTCCTGG - Intronic
1053539286 9:38957095-38957117 GCAGTTGCTCACCTCAGTCCTGG - Intergenic
1054626853 9:67406823-67406845 GCAGTTGCTCACCTCAGTCCTGG + Intergenic
1057172961 9:92974949-92974971 GCAAGGGACAAGCTCAGCCCTGG + Intronic
1057631458 9:96722259-96722281 GCAAGGGCTGAGCTTCTTCCTGG - Intergenic
1057806867 9:98225708-98225730 GGGAAGGCTCAGCACAGTCCTGG + Intronic
1060206227 9:121684424-121684446 AGAAGGGCTCAGCTCAGACGGGG - Intronic
1060549620 9:124478748-124478770 TAAAGGGCTCAGCACCGTCCAGG - Intergenic
1061265323 9:129501474-129501496 CCAAGGGCTCATCCCAGTCCCGG - Intergenic
1061269680 9:129531391-129531413 GCATGGGCACAGCTCCGTGCAGG + Intergenic
1061418425 9:130460680-130460702 GCATGGCCTCAGCCCAGTCCTGG - Intronic
1062046063 9:134425083-134425105 CCAAGGTCTCTGCTCACTCCGGG + Intronic
1062070532 9:134552904-134552926 GCAAAGGCCCAGCCCTGTCCTGG - Intergenic
1062147396 9:134997237-134997259 GCAGGGGCTGAGCTCAGGCCTGG + Intergenic
1062362027 9:136192873-136192895 GCGAGGGCTCTGCGCAGCCCGGG - Intergenic
1062453620 9:136625802-136625824 ACCAGGGCTCAGCTTAGTCTGGG - Intergenic
1185849015 X:3468107-3468129 GCAATTGCTCAGCTCAGTTCTGG - Intergenic
1189359560 X:40339242-40339264 GCAAATGCTTGGCTCAGTCCTGG - Intergenic
1189586249 X:42465152-42465174 TCAAGGGCTCATCTTAGTCAGGG + Intergenic
1192424557 X:71063683-71063705 GCAAGGGATCACCTGAGCCCAGG + Intronic
1197970241 X:132107955-132107977 GCAAGGGCTTAGCACATTCTTGG - Intronic