ID: 1175264078

View in Genome Browser
Species Human (GRCh38)
Location 20:57692148-57692170
Sequence AATGAGACAGTTTGTGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264078_1175264082 7 Left 1175264078 20:57692148-57692170 CCCTTGCCACAAACTGTCTCATT 0: 1
1: 0
2: 1
3: 19
4: 227
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264078_1175264081 6 Left 1175264078 20:57692148-57692170 CCCTTGCCACAAACTGTCTCATT 0: 1
1: 0
2: 1
3: 19
4: 227
Right 1175264081 20:57692177-57692199 TTACGATGCCCCCTGTGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264078 Original CRISPR AATGAGACAGTTTGTGGCAA GGG (reversed) Intronic
900528617 1:3141679-3141701 GATGATACATTTTGTGGAAATGG + Intronic
901573399 1:10180226-10180248 TATGTCACAGTTTGGGGCAACGG + Exonic
901618282 1:10559803-10559825 CCTGAGACAGATTGTGGTAAAGG + Intronic
902527352 1:17067934-17067956 AATGAGAGGGTCTTTGGCAAAGG + Exonic
902657339 1:17878349-17878371 AATGAGGCAGTGTGGGGCAGTGG - Intergenic
903321521 1:22546179-22546201 AATGAGATGATTTGTGCCAAGGG - Intergenic
903497557 1:23779933-23779955 GATGAGACTGTAAGTGGCAAAGG + Exonic
905158666 1:36011302-36011324 AAAGAGCCAGTTTTTGCCAAAGG - Intronic
905549182 1:38822582-38822604 AATGACACTGTCTGTGGCAGGGG - Intergenic
906945182 1:50289041-50289063 AATGAGACAGGTTTGGGCAATGG + Intergenic
907667248 1:56444170-56444192 AATTAGACACTATGTGGCATGGG - Intergenic
908102032 1:60801112-60801134 AATGAGACAATTGGTGATAATGG - Intergenic
908834361 1:68213735-68213757 AATAAGACAGTTTGTTGTTAAGG - Intronic
911409277 1:97482237-97482259 AATAAGACAGTTTAATGCAATGG - Intronic
911714260 1:101112575-101112597 AAGGAAAGAGTTTGAGGCAAAGG - Intergenic
912958164 1:114170745-114170767 AATGAGACAGGCTCTGGCCAAGG - Intergenic
916408531 1:164521855-164521877 AATTAGGAAGGTTGTGGCAAGGG - Intergenic
916737657 1:167622379-167622401 AATAAAACAATTTCTGGCAAGGG + Intergenic
918198469 1:182244676-182244698 AAAGAGACAGCTTGTGGCTTGGG + Intergenic
919327387 1:196125733-196125755 AATGGGGCAGTTTGGGGGAAAGG + Intergenic
920094225 1:203475579-203475601 AATGAGTCTGTTAGTGGGAATGG + Intergenic
920128390 1:203712042-203712064 AATGCCACATTTGGTGGCAATGG - Exonic
921305034 1:213787769-213787791 GATGAGATAGTGTGTGGAAAGGG + Intergenic
1066182267 10:32974609-32974631 AATGAGATAATGTGTGGAAAGGG - Intronic
1067021640 10:42805077-42805099 TATGAGACAATTTGTGACATTGG - Intronic
1068196333 10:53721858-53721880 AGGGAGACAGCTTGTAGCAAAGG - Intergenic
1070226623 10:74515277-74515299 GCTGAGAGAGTTTGTGGCAATGG + Intronic
1070645879 10:78202165-78202187 AATGAAAGAGTTTGTGGGCAGGG + Intergenic
1070994903 10:80769748-80769770 CATGGGACAGTTTCAGGCAATGG + Intergenic
1072390497 10:94980671-94980693 AATGAGACAGTACCTGCCAATGG - Intronic
1072906011 10:99454535-99454557 AATCAGAGACTTTGTGGGAAAGG - Intergenic
1072980770 10:100095266-100095288 AATAAAACAGTGTGTGGCTAGGG + Intergenic
1074098926 10:110338093-110338115 AATGACACAGGTTCTGGCACAGG - Intergenic
1075042319 10:119118027-119118049 AATGAGACTGTTTTTGGCTTGGG - Intronic
1075252299 10:120890621-120890643 AGGAAGACAGTCTGTGGCAAAGG - Intronic
1075361599 10:121841226-121841248 AATGGGCCAGATTGTGGCTATGG - Exonic
1075568062 10:123518989-123519011 AATGGGACAGTGTGTGGCTTGGG + Intergenic
1076326851 10:129630434-129630456 TGTGAGACAGTTTGTTTCAAAGG - Intronic
1076409597 10:130236471-130236493 AATAAGATAATTTGTGGAAAAGG + Intergenic
1077323635 11:1953771-1953793 AAGGAGGCAGTTTGTGAAAAAGG + Intronic
1078385269 11:10885429-10885451 AAAAAGACAGTTAGTGCCAAGGG - Intergenic
1078906802 11:15695298-15695320 AATGACACAATGTGTGACAAGGG - Intergenic
1079646055 11:22864726-22864748 AATGTGCCAGCTTCTGGCAAGGG - Intergenic
1080061526 11:27961583-27961605 AATGAGATAATTTATGTCAACGG + Intergenic
1083135916 11:60676980-60677002 AATGTGACATTTTGGGGGAATGG + Intergenic
1085879542 11:80449722-80449744 AATTAAACATTTTGTAGCAACGG - Intergenic
1088698440 11:112390383-112390405 GATGAGAGAGTTTTGGGCAAAGG - Intergenic
1090156975 11:124448654-124448676 ACTGAGAGAGTTTATGGCAGTGG - Intergenic
1091110844 11:132965017-132965039 AATTAGACAGTTTGTGTCTTTGG + Intronic
1202806622 11_KI270721v1_random:8966-8988 AAGGAGGCAGTTTGTGAAAAAGG + Intergenic
1095366124 12:41407520-41407542 TCTGAGACAGTTTGTGGAAAGGG + Intronic
1095678257 12:44944767-44944789 AATGAGACATTTTCTGGATATGG + Intergenic
1097015743 12:55985981-55986003 AAGGATAGATTTTGTGGCAATGG + Intronic
1097383803 12:58925380-58925402 AATGACACAGTTTGTGTAAGTGG + Intergenic
1097494097 12:60308452-60308474 AAGGAGAGAGTTTTTGTCAATGG - Intergenic
1098138107 12:67424273-67424295 AATGAGGCTGCTTGTGGGAAGGG - Intergenic
1098235457 12:68414133-68414155 AATGTGACAGTATTTGACAATGG + Intergenic
1099408949 12:82300468-82300490 AGTGAGACAGTTTGGCTCAAGGG + Intronic
1100265469 12:92971707-92971729 AAAAAAACAATTTGTGGCAAAGG - Intergenic
1101007370 12:100414145-100414167 TATCACACAGTTAGTGGCAAAGG + Intronic
1101209484 12:102521891-102521913 AATTAAACAGTTTGTGGTGAAGG + Intergenic
1102037628 12:109781299-109781321 GATTAGACAGGTTGTGTCAAAGG - Intergenic
1103013979 12:117479950-117479972 AATGAGACAGTGCGTGGCACAGG + Intronic
1106472977 13:30074369-30074391 GATGAGATAGTTTGTGACAAGGG - Intergenic
1107577525 13:41743151-41743173 AGTGAAACAGATAGTGGCAACGG + Intronic
1108400420 13:50036328-50036350 AATGTGAAAGTTGCTGGCAAAGG + Intergenic
1113124436 13:106961183-106961205 ACTGAGACAGCTTTTGTCAAGGG - Intergenic
1114193639 14:20459176-20459198 AATGAAAGAGGTTGGGGCAAGGG + Intronic
1114466227 14:22924733-22924755 AGTTAGCCAGTTTCTGGCAAAGG + Intronic
1114509240 14:23243322-23243344 GATGAGACAGTTTGTGGCAGGGG - Intronic
1115087114 14:29531052-29531074 AATGGCAAAGTTTGAGGCAAGGG - Intergenic
1115476550 14:33819998-33820020 ACTGAGGCAGTTTCTTGCAATGG - Intergenic
1115518833 14:34212610-34212632 AAAGAGACAATTTGGGGGAAGGG - Intronic
1116914975 14:50515951-50515973 AATGAAAAAGTTTGTGGGAGAGG - Intronic
1119192700 14:72694022-72694044 AATGGGGCAGTTTGAGCCAAGGG + Intronic
1121989881 14:98546339-98546361 AATGATACAAATTGTGGGAATGG + Intergenic
1122403405 14:101481157-101481179 CATGAGTCAGTTTCTTGCAATGG - Intergenic
1125415411 15:39447407-39447429 AATGAGACAGATGGTGAAAATGG - Intergenic
1125440693 15:39700180-39700202 AAGAAGACACTTTGTGGAAAAGG - Intronic
1125499696 15:40231871-40231893 AATGAGTTAGTGTATGGCAAGGG + Intergenic
1127170717 15:56298596-56298618 GATGAGACAGCTTGAGGAAATGG - Intronic
1128284435 15:66424661-66424683 AAAGAGTCCCTTTGTGGCAAAGG - Intronic
1130231240 15:82098793-82098815 AATGAGACACTGTGTGTAAAGGG + Intergenic
1130317419 15:82808757-82808779 ACTGAGACAGGTGGTGGGAATGG - Intergenic
1130567563 15:85009921-85009943 AATGAAACACTTTATAGCAATGG + Intronic
1133459212 16:5972492-5972514 AATGAGAATGTTTCTGGGAAAGG + Intergenic
1133988944 16:10690101-10690123 AAAGGAACAGATTGTGGCAAGGG - Intronic
1140697654 16:77550935-77550957 TATGAGACTTTATGTGGCAAAGG - Intergenic
1141124620 16:81392356-81392378 AGTCAGACAGTATGTGGCAAAGG + Intergenic
1141209178 16:81960089-81960111 AAGGAGACAGTTTTAGGCAGAGG - Exonic
1142814414 17:2414070-2414092 AATGAGACAGTGTGTGTGGAAGG + Intronic
1148554449 17:48569993-48570015 AATGAGACAGGGTGTGACATAGG - Intronic
1150361012 17:64534183-64534205 AATTAGACAGTATCTGACAAAGG - Intronic
1150464123 17:65377303-65377325 AATGTGACAGTCTATGGGAAAGG + Intergenic
1153133821 18:1889568-1889590 AATGAAACATTTAGTGTCAAAGG + Intergenic
1153250352 18:3115710-3115732 AATGAGAGATTTGGTGGCTATGG + Intronic
1153604521 18:6818449-6818471 ATTAACACAGTGTGTGGCAAAGG - Intronic
1156275100 18:35576673-35576695 AATCATACAGTATGTGGCTATGG - Intergenic
1156313858 18:35949885-35949907 AATGAGACGGTGTGTGGGAAGGG - Intergenic
1156621354 18:38855789-38855811 AATGAGACAGCTAGTGGCTGGGG + Intergenic
1157962293 18:52168524-52168546 AATCAGACACCTTGTGACAAAGG - Intergenic
1159049021 18:63399762-63399784 AATGAAACAGTTTGTTAGAATGG + Intronic
1159283894 18:66324164-66324186 AATGAGGCACTTTGTGGTGACGG + Intergenic
1161805381 19:6440490-6440512 AAGGAGACAGTCTGAGGCCAGGG - Exonic
1164354941 19:27413840-27413862 ATTGAGACCTTTTGTGGAAAAGG - Intergenic
1164619513 19:29686236-29686258 AATGAGACAATCTATAGCAAGGG - Intergenic
1167693036 19:50998976-50998998 GATGAGACAGTTTGCGGCTGTGG - Intronic
1167910357 19:52697069-52697091 AAGGAGATGCTTTGTGGCAAAGG + Intergenic
1167918150 19:52759265-52759287 AAGGAGATACTTTATGGCAAAGG + Intergenic
925252079 2:2447964-2447986 AATGAGAGAGTTAATGGAAAAGG - Intergenic
925652604 2:6107398-6107420 AATGAGACACTCTGTGGGCAGGG + Intergenic
925730373 2:6916235-6916257 AATGAGACAAATTGTAGCTAAGG + Intergenic
926948448 2:18214749-18214771 AAGGGAACAGTTTGTGTCAATGG + Intronic
928329784 2:30348795-30348817 AATGAGACTGTATGTGCAAAGGG - Intergenic
930768663 2:55110642-55110664 AATGAGACAGTTTTTTTTAAAGG - Intronic
932532598 2:72552381-72552403 AAGGAGTCAGTGTGTGGCAAAGG + Intronic
934520852 2:95019260-95019282 AAGGACACAGTTTGTGTCATGGG + Intergenic
935179948 2:100680357-100680379 AATCAGAATCTTTGTGGCAAGGG - Intergenic
936019746 2:108985796-108985818 AATGACACAGTTAGGGACAAGGG - Intronic
937282199 2:120726281-120726303 AATGTGACAGTATTTGGTAATGG - Intergenic
938001284 2:127741017-127741039 AGTGACAAAGGTTGTGGCAAAGG + Intronic
940637077 2:156310405-156310427 AATGTGAGAGTTTTTGACAATGG - Intergenic
941042652 2:160640603-160640625 AATAAAACAGATTGTGGCGATGG - Intergenic
941855304 2:170225001-170225023 AATGAGATATTTTGTGTCAAAGG + Intronic
942008072 2:171728899-171728921 AATAAGACAATTTGTTTCAATGG - Intronic
942266466 2:174231677-174231699 AATGAGACAGTCTGTGAATATGG - Intronic
944155510 2:196603446-196603468 AATGATACAGCTTCTGGGAAAGG - Intergenic
944322408 2:198363362-198363384 AACTAGATATTTTGTGGCAAAGG + Intronic
944910955 2:204310061-204310083 AATGAGACAATCAGTGTCAAGGG - Intergenic
945300389 2:208210853-208210875 AATGAGACAGATGGTTGCCAGGG + Intergenic
1169476350 20:5934384-5934406 GATGAGACGGATTGTGGCACTGG - Intergenic
1172129880 20:32648411-32648433 AAAAAGACAGTTTCAGGCAATGG - Intergenic
1172998276 20:39086897-39086919 CATGAGACATTTTGTGGGAGGGG + Intergenic
1175264078 20:57692148-57692170 AATGAGACAGTTTGTGGCAAGGG - Intronic
1177149900 21:17444975-17444997 ATTGAGAAAGTTTTTGGCACTGG + Intronic
1178208306 21:30496688-30496710 ATTGAGACAATTTATTGCAAAGG + Intergenic
1179836456 21:44037571-44037593 AATGAAAGATTTTGTGGAAATGG + Intronic
1180176405 21:46092407-46092429 CATGAGTCAGTTTGTGTCACGGG - Intergenic
1181971537 22:26694156-26694178 AATGAGTCAGATTGCAGCAAGGG + Intergenic
1182138270 22:27928360-27928382 AGTGAGATATTTTGTGGCAAAGG + Intergenic
1182421427 22:30250528-30250550 AATCAGACAGGTTGTGGGAGGGG + Intergenic
1183742563 22:39677097-39677119 AATGGGACAGCTTGTGGTAAAGG + Intronic
1185148439 22:49151483-49151505 GAAGAGACAGAATGTGGCAAGGG + Intergenic
955908555 3:63833736-63833758 AATGAGCCAATTTCTGGAAATGG - Intronic
955958439 3:64314234-64314256 AAGTAGACAGTATGTGACAAAGG + Intronic
956000821 3:64728322-64728344 ATTTGGACAGTTTGTGGCCATGG - Intergenic
959746927 3:109786396-109786418 AATGAGAGATTGTGCGGCAATGG - Intergenic
960219597 3:115089774-115089796 AATTAAACAGTTTGTGTGAAAGG + Intronic
960497624 3:118394624-118394646 AAGGAGACAGTCTGAGGCCAGGG - Intergenic
963323581 3:143836305-143836327 AATGAGACTGTTTAGGGCAGAGG + Intronic
964213846 3:154257156-154257178 AATGAGCCAGTGTGGGGCACTGG + Exonic
964956505 3:162364943-162364965 AATGCTAGAGTTTGAGGCAAAGG - Intergenic
966176221 3:177140395-177140417 GATGAGACTGCTTGTAGCAAAGG - Intronic
966460220 3:180168395-180168417 GCTGAGAGAGTTTGTGGCAGTGG + Intergenic
967231162 3:187338624-187338646 AATGAGACACATTGAGGAAACGG - Intergenic
967575583 3:191087558-191087580 AGTGAGGTAGTTGGTGGCAAGGG + Intergenic
971864810 4:32155941-32155963 GATGAGATAGATTCTGGCAATGG - Intergenic
972641821 4:40932470-40932492 AATATGGCAGTTTCTGGCAAAGG + Intronic
974362920 4:60906158-60906180 AATGATATAGTCTATGGCAAAGG - Intergenic
974470136 4:62309246-62309268 AATGACGCAGTTTGTGGGGATGG + Intergenic
976654090 4:87469149-87469171 CATGAGATGGTTTGGGGCAAGGG + Intergenic
977144603 4:93422169-93422191 AATTAGACAGTTTATTGAAAAGG + Intronic
977195999 4:94060691-94060713 AATGAGACAGGAGGTGGCATTGG + Intergenic
978594183 4:110358999-110359021 ACTGAGACAGTGTCTGGGAAGGG - Intergenic
980114692 4:128667761-128667783 AATGAGACAGATTGTGAAGAAGG + Intergenic
980133172 4:128835440-128835462 AATGAGTGAGTTGGTGGCAGAGG - Intronic
981074373 4:140576851-140576873 AATAAGAATGTTTCTGGCAAAGG - Intergenic
981677982 4:147361738-147361760 AATTAGACAGTTTCTGCCAATGG - Intergenic
982751395 4:159166381-159166403 AATGAGACTGGGTGTGGCAGAGG + Intronic
984037196 4:174684366-174684388 CATGGGACAGTTTGTGGAAGTGG + Intronic
984356455 4:178665704-178665726 AGTAAGAAAGTTTGGGGCAAGGG + Intergenic
986434823 5:7718776-7718798 TATGTGACAGTTTGAGGCAGAGG - Intronic
986625344 5:9718650-9718672 AATCAGGCAGTTAGTGGAAAAGG + Intergenic
986790938 5:11159514-11159536 AAAGAGACAGTGTCTGGCCAGGG + Intronic
987167785 5:15219270-15219292 AATGTGACTGTATGTGGAAATGG - Intergenic
987677426 5:21092384-21092406 AAAGAGACACTTTATGTCAAAGG - Intergenic
989252346 5:39332297-39332319 AATGAGACAGCTGGAGGAAAAGG - Intronic
989945335 5:50219875-50219897 AATGAGACCTATTGTGGAAAAGG - Intergenic
992846331 5:80752648-80752670 AATGAGACAGTATATGTAAAAGG + Intronic
992945474 5:81804503-81804525 GATGAGACAGTTTGTGGTGAGGG - Intergenic
993085057 5:83353485-83353507 TATGAGACTTTTTGTTGCAAAGG + Exonic
993132956 5:83922247-83922269 ATTGAGACAGTTTGGCTCAAAGG - Intergenic
999016856 5:148116173-148116195 AATGAGACCCTTCCTGGCAAAGG + Intronic
999387223 5:151162687-151162709 AATGAGGCAGTGTCTGGCAAGGG + Intergenic
1000268890 5:159664172-159664194 AGTGAGTCAGTCAGTGGCAAAGG - Intergenic
1000707364 5:164528232-164528254 ACTGAGATAATGTGTGGCAAAGG - Intergenic
1002156660 5:177286931-177286953 AATGAGACAGGATGTGCTAAGGG + Intronic
1008027874 6:46658744-46658766 GATCAGACAGTGTGTGGGAAGGG + Intronic
1008373945 6:50770074-50770096 AAAGAGACAGTTTGTGCCTGGGG + Intronic
1008818333 6:55597742-55597764 AATGAGACAGTTTGTAAAAATGG + Intergenic
1009452726 6:63820050-63820072 AATCTGACAGTATGTGGAAATGG - Intronic
1009582923 6:65558905-65558927 AATGAGAGAGTTTGATGAAATGG + Intronic
1010047517 6:71463622-71463644 GGTGAGATGGTTTGTGGCAAGGG + Intergenic
1010240880 6:73614524-73614546 AATGAGACAATTGGTGGCTGGGG + Intronic
1010364148 6:75030462-75030484 AATGAGATAGTTTATGTAAAGGG - Intergenic
1010366903 6:75061375-75061397 AATGAGACAACGTGTGGAAAAGG + Intergenic
1011049600 6:83130238-83130260 ACTGACACAGTCTGTGGCCATGG + Exonic
1011243362 6:85296296-85296318 ATTGAGGAAGTTTGTGCCAATGG + Intergenic
1011562308 6:88632909-88632931 AAAGAGACAATATGTGGGAAAGG - Intronic
1011940171 6:92833137-92833159 GGTGAGACAGTTTGAGGCAAAGG - Intergenic
1013192594 6:107816335-107816357 AAGGAAACAGTATGTGGAAAAGG - Intronic
1013734143 6:113206171-113206193 AATAAGGCAGTGTGTGTCAAAGG - Intergenic
1016232538 6:141823788-141823810 AATGAAAGAGTTTGAGGGAAGGG - Intergenic
1018358546 6:163042395-163042417 CATTAGACAATTTGTGGAAATGG - Intronic
1018617380 6:165700587-165700609 AATAAGAGAGTTTGGGGGAAAGG + Intronic
1019717780 7:2548264-2548286 AAAAAGACATTTTGAGGCAAAGG + Intronic
1019820063 7:3235769-3235791 AATGGGAGAGATGGTGGCAATGG + Intergenic
1021534993 7:21693734-21693756 AATGAACCAGTGTGTGCCAATGG - Intronic
1023751744 7:43379573-43379595 AATGAGGCAGTGTCAGGCAAGGG - Intronic
1024698323 7:51879391-51879413 AATGAGATATTTTGTTGCAGTGG + Intergenic
1024934821 7:54701481-54701503 GATGAGAGAGATTGAGGCAAGGG + Intergenic
1026646272 7:72172060-72172082 GATGAGCCTGTTTGTGACAATGG - Intronic
1027613274 7:80389631-80389653 AATGAGACAGTGTGAGGAAAAGG - Intronic
1028233423 7:88331585-88331607 CATGAGCCAGTATGTGGGAATGG + Intergenic
1029912530 7:104169523-104169545 AATAAGGCAGTTTGATGCAAAGG + Intronic
1030364297 7:108627884-108627906 AATGAGACAGTTTGTTGATCTGG + Intergenic
1030984573 7:116226319-116226341 AATAACACAATTTGTGCCAAGGG + Intronic
1032707333 7:134432680-134432702 AATGAGACAGTGTATGTAAAGGG + Intergenic
1033013898 7:137652091-137652113 TAAGACACAGTTTGTGGCTAAGG + Intronic
1040846919 8:51853183-51853205 AAGGAAACAATTTTTGGCAAGGG + Intronic
1041966915 8:63688792-63688814 AAGCAGACAGTTTGTGAAAAGGG + Intergenic
1042200748 8:66277730-66277752 AAAGAGACAGTTTGGGAAAAGGG + Intergenic
1042508458 8:69586452-69586474 AATTACACTGTTTGTCGCAATGG + Exonic
1043441853 8:80283279-80283301 ATTGAGACAGTTCATGGAAAGGG + Intergenic
1043775102 8:84256945-84256967 AATGAGATAATTTCTGGCCATGG + Intronic
1049565489 8:143335819-143335841 ACTGAGTCAGTTGGTGGCAGGGG - Intronic
1050646976 9:7730790-7730812 AATGAGATAGTCTGTTGCGATGG + Intergenic
1051468136 9:17404077-17404099 AAAGACAGAGTTTATGGCAAGGG + Intronic
1051557109 9:18396209-18396231 GATAAGACAGTTGGTGGCCATGG + Intergenic
1052216079 9:25966808-25966830 TATGAGACAGATTGTAGCAGAGG - Intergenic
1052822045 9:33145256-33145278 CATCTGACACTTTGTGGCAACGG + Intronic
1055158108 9:73089564-73089586 TATGATACATTTTATGGCAAAGG + Intergenic
1056416807 9:86385258-86385280 GATGAGAGAGTTTGTGGTGATGG + Intergenic
1058330124 9:103750164-103750186 AATGAGATAGCTTGGGGAAAAGG + Intergenic
1060487954 9:124061431-124061453 AAGGAGACAGTGTTCGGCAAGGG - Intergenic
1060871466 9:127044719-127044741 AAGGAGAGAGAGTGTGGCAAAGG - Intronic
1185661095 X:1729583-1729605 AATGAGACAGCTTTTGGAATAGG - Intergenic
1187145596 X:16634352-16634374 AATGAGACATTTTGAGGAAGAGG - Intronic
1188160179 X:26790791-26790813 AATGAGTCATTTTATGGAAAAGG - Intergenic
1188455382 X:30358696-30358718 ACTGAGTCAGTTTGGGGCAAAGG - Intergenic
1188532113 X:31153277-31153299 AAAGAAACAGTTTGCTGCAAGGG - Intronic
1189288483 X:39868609-39868631 AATGTGACAGTATTTGGAAATGG - Intergenic
1193481809 X:82036225-82036247 AATGAGACAGCAGGTGGAAAGGG + Intergenic
1194786070 X:98085854-98085876 AATGAGGAAGTTTGGGGAAAAGG + Intergenic
1195575181 X:106441318-106441340 GATGAGTCAGTTGGTAGCAAGGG + Intergenic
1197936767 X:131747613-131747635 AAAGAGACAGTTTGATGCCACGG - Intergenic
1199222463 X:145333384-145333406 AATGAGACAACTTGTGGAAGAGG + Intergenic
1200362105 X:155618132-155618154 CATGAGAAAGCTTGTGGCAATGG - Intronic