ID: 1175264079

View in Genome Browser
Species Human (GRCh38)
Location 20:57692149-57692171
Sequence AAATGAGACAGTTTGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264079_1175264082 6 Left 1175264079 20:57692149-57692171 CCTTGCCACAAACTGTCTCATTT 0: 1
1: 0
2: 5
3: 28
4: 287
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264079_1175264081 5 Left 1175264079 20:57692149-57692171 CCTTGCCACAAACTGTCTCATTT 0: 1
1: 0
2: 5
3: 28
4: 287
Right 1175264081 20:57692177-57692199 TTACGATGCCCCCTGTGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264079 Original CRISPR AAATGAGACAGTTTGTGGCA AGG (reversed) Intronic
901153434 1:7119968-7119990 AAATGTGACAGTTGGTCGAAAGG - Intronic
903235877 1:21950549-21950571 AAATGAGAGAATTTCAGGCAGGG - Intergenic
903321522 1:22546180-22546202 AAATGAGATGATTTGTGCCAAGG - Intergenic
904839127 1:33359901-33359923 AAAGGAGGCAGTTTTTGGCTGGG + Intronic
905152376 1:35940916-35940938 AGATCAGACAGACTGTGGCATGG - Intronic
905549183 1:38822583-38822605 TAATGACACTGTCTGTGGCAGGG - Intergenic
906856503 1:49312067-49312089 AAATGAGACAATTTCTGCTATGG + Intronic
906865084 1:49409412-49409434 AAATGAGACACTTTTGGGGAGGG + Intronic
907412781 1:54294349-54294371 AGAAGGAACAGTTTGTGGCAGGG - Intronic
907667249 1:56444171-56444193 AAATTAGACACTATGTGGCATGG - Intergenic
909626745 1:77725645-77725667 AAATCAGGCAATTTGTGGCCAGG - Exonic
909866326 1:80677050-80677072 AGATAAGACAGTAAGTGGCACGG - Intergenic
909971698 1:81998367-81998389 AAAAGAGACAGTGTGTGTCTTGG - Intergenic
910042896 1:82874812-82874834 AAGTGACATAGTTTGTTGCAGGG - Intergenic
910140211 1:84018819-84018841 AAATGACACAGTGTGTGGCAGGG + Intergenic
910698952 1:90051345-90051367 AAGTGAGATATTTTGTGGCAAGG - Intergenic
910996878 1:93115335-93115357 TAATCAGACAGTTTGTGATATGG + Intronic
911269080 1:95778545-95778567 AAATGAGTCATTTTAAGGCAAGG - Intergenic
911419324 1:97619722-97619744 AAATTAGATAGTTTGTGTAATGG - Intronic
911660217 1:100493225-100493247 CAATGAAACTGATTGTGGCAAGG + Intronic
913034469 1:114949645-114949667 AAATGAGACAGTATAGGGAAGGG - Intronic
913681435 1:121189406-121189428 AAAATAGTCTGTTTGTGGCAAGG - Intronic
914033266 1:143977043-143977065 AAAATAGTCTGTTTGTGGCAAGG - Intergenic
914156180 1:145090924-145090946 AAAATAGTCTGTTTGTGGCAAGG + Intronic
915493122 1:156262745-156262767 AGATGAGACGGTTTGGGTCAGGG - Intronic
916408532 1:164521856-164521878 AAATTAGGAAGGTTGTGGCAAGG - Intergenic
916519175 1:165548151-165548173 AAATGAGTCTGTTTGTGAAATGG - Intronic
916737656 1:167622378-167622400 AAATAAAACAATTTCTGGCAAGG + Intergenic
917150905 1:171943630-171943652 AAATGAGACAATTGGAAGCAGGG - Intronic
917826588 1:178828150-178828172 AAAGGAGACAGTCTATGGAATGG + Intronic
918198468 1:182244675-182244697 CAAAGAGACAGCTTGTGGCTTGG + Intergenic
920468749 1:206207924-206207946 AAAATAGTCTGTTTGTGGCAAGG - Intronic
921305033 1:213787768-213787790 AGATGAGATAGTGTGTGGAAAGG + Intergenic
921313133 1:213865108-213865130 AAATGAGACAATATATGTCAAGG - Intergenic
921528209 1:216244610-216244632 AAATGAGACAGTCTTATGCATGG + Intronic
921634089 1:217472156-217472178 AAATGATCAAGTTTGTTGCATGG + Intronic
922355155 1:224768466-224768488 AAATGAGACAGCTTATTGGAAGG - Intergenic
923300861 1:232639259-232639281 AAATGAAAAAGTGTGTTGCAGGG - Intergenic
923906607 1:238391977-238391999 TAAGTAGACAGTTGGTGGCAGGG + Intergenic
924699339 1:246435272-246435294 ACATGTGCAAGTTTGTGGCATGG - Intronic
924880804 1:248160088-248160110 AAATGAGAAGATTGGTGGCAAGG - Intergenic
1063035314 10:2281148-2281170 AAAACACACAGTGTGTGGCAAGG - Intergenic
1065271163 10:24035338-24035360 AAATGCTACAGGCTGTGGCAGGG - Intronic
1065601770 10:27375997-27376019 CCACGGGACAGTTTGTGGCAAGG + Intergenic
1065860938 10:29871954-29871976 GACTGAGAGAGTATGTGGCAGGG - Intergenic
1067050562 10:43016076-43016098 AAATGAGAAAGTATGTGATATGG + Intergenic
1069283186 10:66681067-66681089 TGATGAAACAGTTTGTGCCATGG + Intronic
1070413507 10:76166941-76166963 AAATAAGACAGATGCTGGCAAGG - Intronic
1070472183 10:76792158-76792180 AAACAAGACAATTTGTGGTAAGG - Intergenic
1071192868 10:83122585-83122607 ATTTAAGACAATTTGTGGCATGG - Intergenic
1072980769 10:100095265-100095287 AAATAAAACAGTGTGTGGCTAGG + Intergenic
1073570206 10:104574851-104574873 AAAGGAGACTGTTTCTTGCATGG + Intergenic
1075042320 10:119118028-119118050 TAATGAGACTGTTTTTGGCTTGG - Intronic
1075568061 10:123518988-123519010 CAATGGGACAGTGTGTGGCTTGG + Intergenic
1075859247 10:125660751-125660773 AAAAGAGACAATTTATGGGAAGG + Intronic
1076991388 11:277976-277998 AAATGTGAGAGTGTGTGGAACGG - Intergenic
1078138926 11:8676986-8677008 AAAGGAGGTGGTTTGTGGCAAGG - Intergenic
1078177721 11:8982718-8982740 AAATGTGACAGTTTGGGGCAAGG + Exonic
1078906803 11:15695299-15695321 AAATGACACAATGTGTGACAAGG - Intergenic
1079267811 11:18951862-18951884 AAATGACACAGTTTCAGGCTGGG + Intergenic
1079970346 11:27029202-27029224 AAATGAGACAGTTCATGTGAAGG - Intergenic
1081029794 11:38064845-38064867 AAATGACACAGTTGTTGGTAAGG - Intergenic
1081197938 11:40184366-40184388 AAAAGAGACAATTTGTGGTAAGG - Intronic
1081634301 11:44710729-44710751 AAATGACACAATTTGTGCAAAGG - Intergenic
1084378434 11:68794704-68794726 AAAATATACAGTTTGTGGCCGGG - Intronic
1085506816 11:77065713-77065735 AGGTGAGACATTTTGAGGCAGGG - Intergenic
1088573694 11:111249003-111249025 GACTGAGACAATTTGTTGCATGG + Intergenic
1088781237 11:113136204-113136226 AAAGGAGACAGTTTGAGACATGG + Intronic
1091329926 11:134724356-134724378 TGGTGAGACATTTTGTGGCACGG + Intergenic
1094587720 12:31793391-31793413 AAAAGAGATACTTTGTGGCCAGG - Intergenic
1094674830 12:32609596-32609618 AAATGAGAAAGTTGGTGACATGG + Intronic
1095366123 12:41407519-41407541 CTCTGAGACAGTTTGTGGAAAGG + Intronic
1097924417 12:65111508-65111530 AAAGGAAACAGCTTGAGGCAAGG - Intronic
1098050607 12:66448630-66448652 CAATGAGACAGTTTGTGGATGGG - Intronic
1099408948 12:82300467-82300489 AAGTGAGACAGTTTGGCTCAAGG + Intronic
1099410823 12:82324357-82324379 AAATGAGACATCTTGGAGCAAGG + Intronic
1099886002 12:88531742-88531764 AAATGAGAAAATCTGTGGCTAGG + Intronic
1100650295 12:96580206-96580228 AGATCAGACAGATAGTGGCAGGG - Intronic
1101440497 12:104701101-104701123 AGATGAGACTGTGTGTGTCATGG - Intronic
1102212463 12:111137408-111137430 AAATCAGACACTTTGGGGAAAGG + Intronic
1102829933 12:115988760-115988782 AAATAAGACATTTTATTGCAGGG - Intronic
1103217882 12:119217245-119217267 AAAAGACACAGTTTCTGGTAGGG + Intronic
1103694892 12:122807071-122807093 ATATGAGAAAATGTGTGGCAAGG + Intronic
1103781776 12:123403453-123403475 AAATGAGGCCGATTGTGGCCCGG + Intronic
1106472978 13:30074370-30074392 GGATGAGATAGTTTGTGACAAGG - Intergenic
1107742423 13:43465499-43465521 AAATGACTGAGTTTGTGGCTGGG - Intronic
1110050331 13:70888729-70888751 ATAAGAGACAGTTTGAGGAAAGG - Intergenic
1111526699 13:89480517-89480539 AGATGAGACAGTGTGAGGCAGGG + Intergenic
1112368747 13:98776443-98776465 AAATGTGACATTTTCAGGCAGGG + Intergenic
1112874394 13:104017711-104017733 AAATTAGACAGTTTTAGGAATGG - Intergenic
1114274864 14:21133816-21133838 AAAGGAGAAAGTTGGGGGCAGGG + Intergenic
1114380383 14:22197645-22197667 AAATGAGACAGCTTGTGCAGGGG - Intergenic
1114509241 14:23243323-23243345 GGATGAGACAGTTTGTGGCAGGG - Intronic
1115222148 14:31068481-31068503 ACATGAAACAGTGTGTGCCATGG - Intronic
1115518834 14:34212611-34212633 AAAAGAGACAATTTGGGGGAAGG - Intronic
1117537506 14:56715609-56715631 AAATGTGACACTGTGTGGAAAGG - Intronic
1118508457 14:66443328-66443350 AAATGTGACATTTGGTGTCAGGG - Intergenic
1119192699 14:72694021-72694043 AAATGGGGCAGTTTGAGCCAAGG + Intronic
1119450793 14:74708115-74708137 AGATGTGACAGTATGTGCCATGG + Intronic
1120301520 14:82713250-82713272 AGATTACACAGTTTGTGTCAGGG + Intergenic
1120502811 14:85318022-85318044 ATTTGAGTCAGTCTGTGGCATGG + Intergenic
1120582291 14:86267752-86267774 AAACGACACAGATGGTGGCAAGG + Intergenic
1122053727 14:99078216-99078238 AAGTGAGCCACTTAGTGGCAAGG + Intergenic
1122625470 14:103083434-103083456 GAATGAGACAGCTTGTCCCAGGG + Intergenic
1125049614 15:35281873-35281895 AAATCAAACAATTTGTTGCAGGG - Intronic
1125499695 15:40231870-40231892 AAATGAGTTAGTGTATGGCAAGG + Intergenic
1125670492 15:41468726-41468748 GAATGAGATAGTTCCTGGCAAGG + Intronic
1125880201 15:43186741-43186763 AAATGAGAAAGTGGGTGGAAAGG - Intronic
1129606383 15:77027184-77027206 AACTGAGCCAGTTTGTGCCTGGG - Intronic
1129824020 15:78622433-78622455 AAAGGAGACAGTTTGTGGAATGG + Intergenic
1130231239 15:82098792-82098814 AAATGAGACACTGTGTGTAAAGG + Intergenic
1130374522 15:83316825-83316847 AAATGAGAGAGATAGAGGCAAGG - Intergenic
1130558140 15:84937604-84937626 AAAAAAGAAAGTTTGTGGCCAGG + Intronic
1131565500 15:93481888-93481910 AGAAGAGACACTTTGTTGCAGGG + Intergenic
1133595256 16:7284915-7284937 AAAGGAAACAGTGTGTGGCAAGG - Intronic
1134207703 16:12251256-12251278 AAATGAGCTAATGTGTGGCAAGG + Intronic
1134413788 16:14025794-14025816 AAATGATACATTTTTTTGCATGG - Intergenic
1135613668 16:23890616-23890638 AAATGAAGCAGTTGATGGCACGG - Intronic
1137790123 16:51167998-51168020 AAATGAGAGAGTTTATTGGAAGG + Intergenic
1137908781 16:52354289-52354311 GAATGAGGCAGTGTGAGGCAGGG - Intergenic
1139644370 16:68317405-68317427 AGATGAGCCAGATTGTGGCTGGG + Intronic
1139873713 16:70128207-70128229 AAAAAAGACAGTTTTGGGCAGGG - Intronic
1143478384 17:7215752-7215774 ACATGTGTGAGTTTGTGGCAGGG + Intronic
1144551909 17:16248179-16248201 AAATGAGAAAGCTTGAGGCTGGG - Intronic
1144970827 17:19108488-19108510 AACTGAGGCAGCATGTGGCAGGG - Intergenic
1144991129 17:19234650-19234672 AACTGAGGCAGCATGTGGCAGGG - Intronic
1147149918 17:38508776-38508798 AATGGAGGCAGTTTGGGGCAGGG + Intronic
1150042352 17:61877477-61877499 AAATCAGACTGTTTGTGGGTGGG - Intronic
1152003673 17:77663463-77663485 AAATGTGATGGTCTGTGGCAGGG - Intergenic
1153409061 18:4773111-4773133 AAATGAAACAGTTTGTCATATGG - Intergenic
1153484137 18:5578597-5578619 AGAATAGACATTTTGTGGCAGGG + Intronic
1154372652 18:13778673-13778695 AAATGATACAGTTTTTGGTTTGG + Intergenic
1156313859 18:35949886-35949908 TAATGAGACGGTGTGTGGGAAGG - Intergenic
1156621353 18:38855788-38855810 TAATGAGACAGCTAGTGGCTGGG + Intergenic
1156804403 18:41160259-41160281 AAAGGAGACAGTTTTTGGCCTGG + Intergenic
1157400764 18:47384587-47384609 ATATGTGAAAGTTTGTTGCATGG + Intergenic
1157539463 18:48489569-48489591 AAATCAGCCAGATTGTGACAAGG + Intergenic
1157995492 18:52549827-52549849 AAATGAGACAATTTCTGTAAAGG - Intronic
1158446884 18:57529606-57529628 AAAGGAGCCAGTTTGGGGAATGG + Intergenic
1158526732 18:58221189-58221211 AGCTGAGTTAGTTTGTGGCAGGG + Intronic
1160036885 18:75309891-75309913 AAAGGAGAAAATGTGTGGCAGGG - Intergenic
1162746916 19:12803943-12803965 AAATGAGATAATCTGTGGCAGGG + Intronic
1164619514 19:29686237-29686259 AAATGAGACAATCTATAGCAAGG - Intergenic
1164674636 19:30093135-30093157 AAATGACACAGCTGGTGGCCTGG + Intergenic
1165839875 19:38782038-38782060 AAATGAGCCAGTTTTGGGCCAGG + Intergenic
1166008353 19:39923306-39923328 AAATAAGAGAGATTGTGGAATGG + Intronic
1166667895 19:44692236-44692258 AAATGAGTAAGTTGGTGGCAGGG + Intergenic
1167996695 19:53410422-53410444 AAATGTAAGAGTTTGTGACAAGG + Exonic
1168002167 19:53456989-53457011 AAATGTAAGAGTTTGTGACAAGG + Exonic
925052439 2:827448-827470 AAAAGAGTCTGTTTGTGGCCGGG - Intergenic
926580308 2:14627515-14627537 AAATTAGACAATGTGTGGGAAGG - Intergenic
928130802 2:28648754-28648776 AAATGAGAAAGTGTGTGAAAGGG + Intergenic
928329785 2:30348796-30348818 AAATGAGACTGTATGTGCAAAGG - Intergenic
931816866 2:65912722-65912744 AAATCAGACATTATGAGGCAAGG - Intergenic
932066060 2:68562072-68562094 AAATGATACCGTTTGTGATAAGG + Intronic
934520851 2:95019259-95019281 AAAGGACACAGTTTGTGTCATGG + Intergenic
935621485 2:105134214-105134236 AAATTAGAGAGCTGGTGGCAAGG + Intergenic
935740045 2:106139233-106139255 AAATGTGAAAGGTCGTGGCAGGG - Intronic
936226455 2:110658255-110658277 AAATAAGACAGTTCTTGACAAGG - Intronic
938028527 2:127971580-127971602 AAATGAGAAAGTGGGTGGCGGGG - Intronic
939399333 2:141670458-141670480 AAATGATCCTGTCTGTGGCATGG - Intronic
941281199 2:163553699-163553721 AAATGAGCCAGTTTTAGGTAGGG + Intergenic
941850560 2:170175974-170175996 CAATGAGACATTTTGGGGAATGG - Intergenic
944548386 2:200821264-200821286 AAATGAAAAAGTTTGTAGAATGG + Exonic
944861935 2:203823420-203823442 AAAAGAGAGAGGATGTGGCAGGG + Intergenic
944978883 2:205091311-205091333 AAATGATGCAGTTTGTGCCACGG - Intronic
945300388 2:208210852-208210874 AAATGAGACAGATGGTTGCCAGG + Intergenic
947622168 2:231597651-231597673 AGGTGACACAGTTTGTGGGAGGG - Intergenic
1168768686 20:399584-399606 AAATGAGTCTCTTTGTGGAATGG - Intergenic
1169797406 20:9478566-9478588 AAATCAAACAGTTTGTGGTATGG + Intronic
1170325914 20:15154211-15154233 AGATGAGTCAGAGTGTGGCAGGG - Intronic
1170716513 20:18836194-18836216 AAAGGAGAGAGATTGTGGCTGGG - Intergenic
1172093507 20:32449492-32449514 AGATGGGACAGTTTGTCACATGG + Intronic
1172780967 20:37436928-37436950 AGGTGAGGCAGTTTGTTGCAGGG - Intergenic
1172998275 20:39086896-39086918 GCATGAGACATTTTGTGGGAGGG + Intergenic
1173220210 20:41126142-41126164 AAATTTGACAGCTTTTGGCAGGG - Intergenic
1173427743 20:42957605-42957627 AAATGACACAGGGTGAGGCAAGG + Intronic
1175264079 20:57692149-57692171 AAATGAGACAGTTTGTGGCAAGG - Intronic
1175865067 20:62171195-62171217 AAAGGAGCCAGTTTGTGGCCGGG - Intronic
1176970115 21:15255524-15255546 TAAAGAAACAGTTTGTGGCTGGG + Intergenic
1177047953 21:16194496-16194518 AAATAAGCCAGCTTGTGGAAGGG + Intergenic
1177262052 21:18742484-18742506 AAATGAGACAGTTTAAGAGATGG - Intergenic
1177554269 21:22669424-22669446 AAATGAAACAGTGTGGAGCAGGG + Intergenic
1177872075 21:26586251-26586273 AAATAAAACAGCATGTGGCAAGG - Intergenic
1178385178 21:32143287-32143309 AAAGCAGACAGATTGGGGCAGGG - Intergenic
1178437148 21:32569839-32569861 CAGTGACCCAGTTTGTGGCACGG + Intergenic
1178548988 21:33519256-33519278 AAAAGAGGCAGTTTCTGGCCGGG + Intronic
1178723939 21:35034823-35034845 AAATGAGAGAGCTAGTGGCTGGG - Intronic
1178920899 21:36737519-36737541 AAACCTGACAGTTTGTGTCATGG + Intronic
1179394835 21:41029600-41029622 AAATGAGGCACTTTCTGGGAAGG + Intergenic
1180176406 21:46092408-46092430 ACATGAGTCAGTTTGTGTCACGG - Intergenic
1181844091 22:25692288-25692310 AAAGGAGGCATTTTGTGGCTAGG + Intronic
1182421426 22:30250527-30250549 AAATCAGACAGGTTGTGGGAGGG + Intergenic
1182806070 22:33071707-33071729 AAATAAGACAGAAAGTGGCAAGG + Intergenic
1182827633 22:33279423-33279445 CAATGGGACACTTTCTGGCAGGG + Intronic
1183290378 22:36998448-36998470 AAATGAGGCTGTTTCTGGTATGG - Intronic
1185148438 22:49151482-49151504 AGAAGAGACAGAATGTGGCAAGG + Intergenic
1185151930 22:49168695-49168717 AAAGGTGACTCTTTGTGGCAAGG - Intergenic
949347867 3:3093783-3093805 AAATAAGACTGTTTCTGCCATGG - Intronic
950257290 3:11515952-11515974 AGATCAGAAAGTTTGTGGAAGGG + Intronic
950807063 3:15614550-15614572 AATGGAGACATTTTGTGGCATGG - Intronic
951491732 3:23277898-23277920 AAGTGAGACTGTTTTTGTCATGG - Intronic
958894882 3:99818264-99818286 AAAAGAGAAAGCTTGTGGAAAGG - Intronic
960355355 3:116645948-116645970 AAATGAAAAAGTTTGTAGAATGG - Intronic
962784642 3:138755990-138756012 AAATAAGACATTTTCTGGAATGG + Intronic
963818500 3:149861104-149861126 AAAAAAGACAGATTTTGGCAAGG + Intronic
964883312 3:161448726-161448748 AAATGAGACAATTAGTGGCTAGG + Intergenic
971296948 4:25402705-25402727 CTATTACACAGTTTGTGGCAAGG + Intronic
974369043 4:60989939-60989961 GATTGAGACAGTTTGTGGCTGGG - Intergenic
976004040 4:80406912-80406934 AAATCAGTCAGTTAGTGGTAGGG + Intronic
976654089 4:87469148-87469170 ACATGAGATGGTTTGGGGCAAGG + Intergenic
977459304 4:97304899-97304921 AAAAGATACAGTTTGTGGTTTGG - Intronic
978058539 4:104306275-104306297 AAATAAAACAGTTGTTGGCATGG - Intergenic
978594184 4:110359000-110359022 AACTGAGACAGTGTCTGGGAAGG - Intergenic
979602693 4:122603783-122603805 AATTTATTCAGTTTGTGGCATGG + Intergenic
981171258 4:141625779-141625801 AGATGAGACATTTTGAAGCAGGG - Intergenic
984246058 4:177276315-177276337 AAATTAGAAAATTAGTGGCATGG - Intergenic
984535786 4:180973577-180973599 AAATGAGACAGTGTTTGAAAGGG - Intergenic
986130011 5:4921022-4921044 AAATGAGACAGTTTCCGATAAGG + Intergenic
986176649 5:5358309-5358331 AAAAGAGAAAGTATGTGGAAGGG - Intergenic
986573708 5:9191325-9191347 ATATAAGACTGTTTCTGGCAAGG + Intronic
987133449 5:14880295-14880317 AAACGGGATAGTTTGGGGCAGGG + Intergenic
988335422 5:29902185-29902207 AAATAAGACTGTTAGTGGTATGG + Intergenic
988388601 5:30598470-30598492 CAAAGAGAGTGTTTGTGGCAGGG + Intergenic
989181536 5:38582278-38582300 AAATCAGGCAGTTTGTTGCTTGG + Intronic
989350817 5:40484524-40484546 AAAAAAGACAGATTATGGCAGGG + Intergenic
989514827 5:42329509-42329531 AAATGGTACAGACTGTGGCAAGG - Intergenic
989664911 5:43842664-43842686 AAATGACACAGTGTGTGCAAAGG + Intergenic
989679199 5:44009179-44009201 AAATGTGCCAGTTTGTTACATGG + Intergenic
990654652 5:57941719-57941741 AGATGAGACAGTGTGTGGAAAGG + Intergenic
991089500 5:62680295-62680317 AAAAGAAAGAGTCTGTGGCAAGG + Intergenic
992945475 5:81804504-81804526 GGATGAGACAGTTTGTGGTGAGG - Intergenic
993082012 5:83313042-83313064 AAAAGAGACATTTTTTGGCATGG - Intronic
994347873 5:98708994-98709016 AACTGAGTCTGTTTGGGGCAAGG + Intergenic
994502612 5:100599224-100599246 AAATGAGGCAGCCTCTGGCAGGG - Intergenic
995834087 5:116383277-116383299 AACTGAGCCAGTGTGAGGCATGG + Intronic
997906281 5:137820861-137820883 AAATGAGACAGTGTATGTAAAGG - Intergenic
998871914 5:146561172-146561194 TAATGCCACAGTTTGTGGGAGGG + Intergenic
999387222 5:151162686-151162708 GAATGAGGCAGTGTCTGGCAAGG + Intergenic
1000251409 5:159499118-159499140 AAATGAGACAGTTTGAGGCCAGG + Intergenic
1000944589 5:167405093-167405115 AACTGACACATTCTGTGGCACGG - Intronic
1002156659 5:177286930-177286952 AAATGAGACAGGATGTGCTAAGG + Intronic
1002782825 6:380089-380111 ACATCAGACATTTTGTGCCAGGG - Intergenic
1002925259 6:1602097-1602119 AAAGGAGAGAGTGGGTGGCAGGG - Intergenic
1003647128 6:7922042-7922064 AAATGATACAACATGTGGCAGGG - Intronic
1003833887 6:10045985-10046007 AAATGAGAGAGTTTGTGTATGGG - Intronic
1005236804 6:23773017-23773039 AGATCAGACAGGTTCTGGCAAGG - Intergenic
1005370464 6:25126788-25126810 AAATGTGTCATTTTGTGACATGG - Intergenic
1007251280 6:40496775-40496797 ATATGAGACCCTTTGGGGCAAGG + Intronic
1007358179 6:41335746-41335768 AAATGAGACAGGCTGAGGCCTGG - Intronic
1008027873 6:46658743-46658765 AGATCAGACAGTGTGTGGGAAGG + Intronic
1008133253 6:47741993-47742015 AAATTAGACAATTTCTGGCTGGG - Intergenic
1008373944 6:50770073-50770095 AAAAGAGACAGTTTGTGCCTGGG + Intronic
1009191631 6:60635970-60635992 AAATGAAACAGTGTTTGCCAAGG - Intergenic
1010240879 6:73614523-73614545 TAATGAGACAATTGGTGGCTGGG + Intronic
1011053897 6:83185118-83185140 AAAGAATACAGTTTGGGGCAGGG + Intronic
1012865133 6:104609732-104609754 AGATGAGAAAATTTGTGACAAGG + Intergenic
1015856565 6:137631333-137631355 CAATGAGAAAGTTTGTTACAGGG + Intergenic
1018737426 6:166697888-166697910 AAATGAGGCAGGATCTGGCACGG + Intronic
1022446839 7:30478037-30478059 AAATGAGACAATGCTTGGCAAGG - Intronic
1022483251 7:30758043-30758065 AAGTGAAACAATTAGTGGCAGGG - Intronic
1022791395 7:33692740-33692762 AACTGAGAGCGATTGTGGCAAGG + Intergenic
1022920962 7:35014331-35014353 AAAAGAGACAGTTTTTAGCTTGG + Intronic
1026394781 7:69940501-69940523 AAGTGAGAGAGTGTGTGTCATGG + Intronic
1026459132 7:70597980-70598002 AGAAGAGACAGTGAGTGGCATGG + Intronic
1028171610 7:87603502-87603524 ATATGATATAGTCTGTGGCAGGG - Intronic
1029908834 7:104122026-104122048 GAATGAGAGAGTTTCTGGCCTGG - Intergenic
1030317770 7:108133639-108133661 AAATGACACAGCTTTTGGCCGGG - Intergenic
1030626814 7:111853812-111853834 CAATAAAACAGTGTGTGGCAGGG - Intronic
1032685972 7:134234088-134234110 AAATGAAACAGTTTAGAGCAGGG - Intronic
1032707332 7:134432679-134432701 AAATGAGACAGTGTATGTAAAGG + Intergenic
1034776344 7:153830415-153830437 AAATGAAACAGTGATTGGCATGG + Intergenic
1034899849 7:154900994-154901016 CAATGAGACAGCTTCTGGCCTGG + Intergenic
1035948265 8:3989821-3989843 AAATGTGACATTTTGTTGCTTGG - Intronic
1039138219 8:34351945-34351967 ACACCAGAGAGTTTGTGGCAAGG + Intergenic
1039989087 8:42472995-42473017 AAATGAGAAATTTAGTTGCATGG + Intronic
1042200747 8:66277729-66277751 AAAAGAGACAGTTTGGGAAAAGG + Intergenic
1042321419 8:67479337-67479359 AAATGTGGCAATTTGAGGCAAGG - Intronic
1043441852 8:80283278-80283300 AATTGAGACAGTTCATGGAAAGG + Intergenic
1045396387 8:101764599-101764621 AAATGGGATAGTTGTTGGCAGGG + Intronic
1045574994 8:103410879-103410901 AAATGAAACAGGTTGTGTAAGGG - Intronic
1045898831 8:107250155-107250177 AAAAGAGACAGTTGTTGGCAAGG - Exonic
1046179501 8:110625509-110625531 AAGTGATACAGTTAATGGCAGGG - Intergenic
1046603412 8:116343875-116343897 AAAGGAGCCAGTTTGAGGCCTGG - Intergenic
1047131131 8:122020997-122021019 AAAAGAAACATTTTGTGGCCAGG - Intergenic
1049483584 8:142839715-142839737 AACTGAGACATTTTCTCGCAGGG - Intronic
1049565490 8:143335820-143335842 CACTGAGTCAGTTGGTGGCAGGG - Intronic
1049581707 8:143414674-143414696 TTATGAGACAGTATGTGGCTGGG - Intergenic
1050734969 9:8751830-8751852 AAACGAGACAGTTTGTTATATGG + Intronic
1051468135 9:17404076-17404098 AAAAGACAGAGTTTATGGCAAGG + Intronic
1053410901 9:37915573-37915595 AAAGGAGACACTGTGTGGCCAGG + Intronic
1054746145 9:68855797-68855819 AAATGATACAGTTTGTGGGTAGG + Intronic
1054746308 9:68857362-68857384 AAATTATACAGTTTGTGGGTAGG - Intronic
1057544324 9:96006051-96006073 AAATGTGACATTCTGTGGGAAGG + Intronic
1057867032 9:98689695-98689717 AAATGACAGGGTTTATGGCACGG + Intronic
1057897994 9:98924896-98924918 AAATCACTCAGTTTGTGGCAAGG - Intergenic
1060487955 9:124061432-124061454 AAAGGAGACAGTGTTCGGCAAGG - Intergenic
1185473285 X:397951-397973 AAAAGAGAGAGTTTTTGTCACGG - Intergenic
1186116695 X:6311363-6311385 AAATGAGCCAGTTTATGGATCGG + Intergenic
1187155073 X:16714252-16714274 AAATGAGACAGTTTGGGGTGTGG + Intergenic
1188137499 X:26507452-26507474 AAATGAGATAGTTTGTATAAAGG - Intergenic
1188480620 X:30633639-30633661 AAATGAGACAGTGGTTGGGAAGG - Intergenic
1188532114 X:31153278-31153300 AAAAGAAACAGTTTGCTGCAAGG - Intronic
1189052800 X:37664124-37664146 AAATGAGGCACTTGCTGGCAAGG + Intronic
1191847035 X:65554676-65554698 AAATGAGACATCTTTGGGCAAGG + Intergenic
1193261783 X:79416132-79416154 AAAGGTGACATTGTGTGGCAAGG - Intergenic
1193433365 X:81439783-81439805 AAATGAAACAGTTTTTCTCATGG - Intergenic
1194981156 X:100441525-100441547 AAATGAGTCAGTTGTTGGCCGGG - Intergenic
1195406738 X:104522763-104522785 TAATGAGACAGTGTGAAGCAGGG - Intergenic
1195575180 X:106441317-106441339 AGATGAGTCAGTTGGTAGCAAGG + Intergenic
1195899604 X:109783616-109783638 AACTGAGGCAGTTTGGGTCACGG - Intergenic
1196123080 X:112070948-112070970 AAATAAGACAATTTGTGTAAAGG - Intronic
1196999918 X:121427881-121427903 AATTGAGACAATTTTTCGCAAGG + Intergenic
1197020631 X:121683630-121683652 TAAAGAGACAGTTTGTTTCAAGG + Intergenic
1197161058 X:123322228-123322250 ATATAATGCAGTTTGTGGCAAGG - Intronic
1197855279 X:130907816-130907838 TTATGATACAGTTTGTGGCCAGG + Intergenic
1199081053 X:143577275-143577297 AAATGAGGCACTTTGTCCCAAGG + Intergenic
1199296147 X:146161234-146161256 AAATGAGACAGTTATTGTCAAGG + Intergenic
1199426390 X:147705784-147705806 ACATGTGCCAGTTTGTTGCATGG - Intergenic
1201860143 Y:18588143-18588165 AAGTGAGACAGTCTAAGGCAGGG + Intronic
1201873178 Y:18732238-18732260 AAGTGAGACAGTCTAAGGCAGGG - Intronic