ID: 1175264080

View in Genome Browser
Species Human (GRCh38)
Location 20:57692154-57692176
Sequence GAATTAAATGAGACAGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 2, 1: 0, 2: 6, 3: 35, 4: 510}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264080_1175264081 0 Left 1175264080 20:57692154-57692176 CCACAAACTGTCTCATTTAATTC 0: 2
1: 0
2: 6
3: 35
4: 510
Right 1175264081 20:57692177-57692199 TTACGATGCCCCCTGTGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1175264080_1175264082 1 Left 1175264080 20:57692154-57692176 CCACAAACTGTCTCATTTAATTC 0: 2
1: 0
2: 6
3: 35
4: 510
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264080 Original CRISPR GAATTAAATGAGACAGTTTG TGG (reversed) Intronic
900771626 1:4549443-4549465 GAAGATAATGAGTCAGTTTGAGG - Intergenic
902051957 1:13570799-13570821 GCATTAAATGCAATAGTTTGAGG - Intergenic
902302494 1:15511989-15512011 GGAGTAAATGAGGCAGTGTGTGG - Intronic
902597443 1:17519245-17519267 GAATTAAATGAGACTGTGTAGGG - Intergenic
903207639 1:21794939-21794961 GAATCAAGAGGGACAGTTTGAGG - Intergenic
903240204 1:21977593-21977615 GAATTACATGAGAAAGTATAAGG - Intronic
903312595 1:22471547-22471569 GAATTAAATGAGAAAGTGTGTGG + Intronic
904712980 1:32444984-32445006 GCATTAAATGCAATAGTTTGAGG + Intergenic
905061177 1:35140367-35140389 GCATTAAATGCAATAGTTTGAGG + Intergenic
905849459 1:41262625-41262647 GAATTAAATGAGACAAAGTCTGG + Intergenic
906921249 1:50066917-50066939 TACATCAATGAGACAGTTTGAGG - Intronic
908817317 1:68047627-68047649 GAATTTAATAAAACAGTTTAAGG - Intronic
910437900 1:87224283-87224305 GAATTAAATTATCCACTTTGTGG - Intergenic
910457747 1:87415591-87415613 GAATTAATTGAGTGAGTTTAAGG - Intergenic
910808104 1:91208600-91208622 GCATTAAATGCAATAGTTTGAGG + Intergenic
910842379 1:91572681-91572703 GAAGTAAGTGAGACAATTTAGGG - Intergenic
910852983 1:91666720-91666742 GCATTAAATGCAATAGTTTGAGG + Intergenic
911121439 1:94301059-94301081 GAGTTAAACGAGAAAGTTTCTGG - Intergenic
912160022 1:106971052-106971074 GAATTAAGTGAGATAATTTTGGG + Intergenic
912527844 1:110297957-110297979 GGATTAAATGAGACACCTTATGG + Intergenic
912669448 1:111610854-111610876 AAATTAAATGAGATAATATGAGG - Intronic
912980440 1:114366227-114366249 GCATTAAATGCAATAGTTTGAGG + Intergenic
913054107 1:115141631-115141653 GAATAAAGTGAAACAATTTGGGG - Intergenic
914315017 1:146502063-146502085 GAATTAATTGAGTGAGTTTAAGG - Intergenic
914499336 1:148231309-148231331 GAATTAATTGAGTGAGTTTAAGG + Intergenic
914898835 1:151700698-151700720 AAATGATATGAGAAAGTTTGTGG + Intergenic
914989666 1:152487250-152487272 GAATCAAATGGGACTGGTTGGGG - Intergenic
915708481 1:157870474-157870496 AAAATAAATGAGTCAGTATGGGG - Intronic
916245594 1:162685297-162685319 GAATGAAATGGGACAGTGGGTGG + Intronic
917264721 1:173208452-173208474 TACTTAAAAGAGAAAGTTTGTGG + Intergenic
917294622 1:173505781-173505803 GGATTAAATGAGATAATATGTGG - Intronic
917503764 1:175609880-175609902 CACTCAACTGAGACAGTTTGAGG + Intronic
917950742 1:180031896-180031918 AAAAGAAATGAGATAGTTTGTGG - Intronic
918004858 1:180532547-180532569 GAAGAAATTGAGACAGTATGTGG + Intergenic
918031333 1:180815226-180815248 GAATTAATTGCTACAATTTGAGG + Intronic
918152618 1:181811042-181811064 GAATTAAATGAGACCCTCTGTGG - Intergenic
918843431 1:189575673-189575695 GCATGAAATGAGACATTTTGAGG + Intergenic
919321240 1:196041883-196041905 CACATAAATGAGGCAGTTTGTGG + Intergenic
921007290 1:211106935-211106957 AAATTAAATGTGAAAGTTAGAGG - Intronic
921074616 1:211690309-211690331 GCATTAAATGCAATAGTTTGAGG - Intergenic
921320163 1:213930967-213930989 GAAGTAAATGAGAAAGTCAGAGG - Intergenic
921447392 1:215262694-215262716 GGATAAAATGACACACTTTGTGG - Intergenic
922049164 1:221973940-221973962 GAATTAAGAGTGGCAGTTTGGGG + Intergenic
922680795 1:227593650-227593672 GCATTAAATGCAATAGTTTGAGG + Intronic
922690131 1:227682454-227682476 GCATTAAATGCAATAGTTTGAGG - Intergenic
923781496 1:237029563-237029585 CAAATACATGAGACAGTTTTGGG + Intergenic
923852391 1:237811246-237811268 GAATTAAAGGACAGAGGTTGAGG + Intronic
924706309 1:246505627-246505649 GAATTTAATGAAAGAGTTTTGGG - Intronic
924716509 1:246579886-246579908 GAATAAAATGAGACAATTTATGG - Intronic
924859101 1:247902595-247902617 GCATTAAATGCAATAGTTTGAGG + Intergenic
1064960420 10:20957916-20957938 CAATTAGCTGAGACAGTCTGGGG - Intronic
1065930977 10:30478920-30478942 GCATTAAATGCAATAGTTTGAGG - Intergenic
1066347328 10:34600722-34600744 GAATAAAATGATACTGTTTGGGG - Intronic
1068212548 10:53939844-53939866 GAATCAAAAGAGAAAGTTTCGGG + Intronic
1068556004 10:58459646-58459668 GAATTAAATGAGACAATGTGTGG - Intergenic
1068671821 10:59730740-59730762 GCATTAAATGCAATAGTTTGAGG + Intronic
1068675822 10:59768308-59768330 GCATTAAATGCAATAGTTTGAGG + Intergenic
1069676642 10:70253517-70253539 GGATTAAATGAGACGGTGTCTGG + Exonic
1069866378 10:71506140-71506162 GAATGAAATAATACAGTATGTGG - Intronic
1069939220 10:71942930-71942952 GCATTAAATGCAATAGTTTGAGG - Intergenic
1070057137 10:72946192-72946214 GAATTAAATCATACAATATGTGG + Intronic
1070403024 10:76070088-76070110 GGATTAAATGAGATAATCTGTGG + Intronic
1070523168 10:77272090-77272112 GAAGGAAATGAAACAGTGTGAGG - Intronic
1071099641 10:82020298-82020320 GAATTAAACAAGGCAGTTTATGG - Intronic
1071283147 10:84120948-84120970 GCATTAAATGCAATAGTTTGAGG + Intergenic
1071472489 10:85993522-85993544 GGATTAAATGGGACAGTAGGAGG - Intronic
1071913390 10:90261972-90261994 GAATAATATTAGGCAGTTTGGGG - Intergenic
1072045666 10:91652210-91652232 GCATCAAATAAAACAGTTTGAGG - Intergenic
1072280338 10:93860320-93860342 GAAGTTAATGGGACAGTTTCTGG - Intergenic
1073497714 10:103908828-103908850 CAAATAAATGAGACTGTTTGAGG - Intronic
1073881165 10:107981565-107981587 AAAATAAATGACACAGTCTGAGG - Intergenic
1075536969 10:123279334-123279356 AGATTAAATGGGACACTTTGTGG + Intergenic
1075628569 10:123984770-123984792 GAAATACATGATACAGTGTGAGG + Intergenic
1076285899 10:129296304-129296326 GAAAAAAATGAGAAAATTTGAGG + Intergenic
1077582342 11:3424430-3424452 GATTTAAATGAAAGTGTTTGGGG - Intergenic
1078177719 11:8982713-8982735 GGCCTAAATGTGACAGTTTGGGG + Exonic
1078858617 11:15226926-15226948 GAAATAACTGACAAAGTTTGGGG - Intronic
1080196851 11:29621338-29621360 AAGTTAAATGAGAAACTTTGAGG + Intergenic
1080239746 11:30113276-30113298 CAATTAAATAAGAAAATTTGTGG + Intergenic
1080584228 11:33666912-33666934 GAACTAAATGAGATAATGTGTGG + Intronic
1080590752 11:33721353-33721375 GATTTAAATGAGACAGGCTCTGG + Intronic
1081097230 11:38952772-38952794 GAATAAAAAGAATCAGTTTGAGG - Intergenic
1083089867 11:60188907-60188929 GCATTAAATGCAATAGTTTGAGG - Intergenic
1083098476 11:60278604-60278626 GTATGAAATGAGACAGTATCAGG - Intergenic
1084239253 11:67807249-67807271 GATTTAAATGAAAGTGTTTGGGG - Intergenic
1084354747 11:68630439-68630461 GAATTAAGAGTGGCAGTTTGGGG - Intergenic
1084833180 11:71785597-71785619 GATTTAAATGAAAGTGTTTGGGG + Intergenic
1085239761 11:75043534-75043556 GCATTAAATGCAATAGTTTGAGG - Intergenic
1085767667 11:79297328-79297350 AAATAAGATGAGCCAGTTTGAGG - Intronic
1085873838 11:80383046-80383068 GAATGAAATGACACTATTTGAGG + Intergenic
1086658520 11:89386391-89386413 GAATTAAGGGTGGCAGTTTGAGG - Intronic
1086973485 11:93107782-93107804 GCATTAAATGCAATAGTTTGAGG + Intergenic
1087158208 11:94924796-94924818 GGGTTAAATAAGACCGTTTGGGG + Intergenic
1087379399 11:97385520-97385542 GATTTAAATCAGAAAGTTAGAGG + Intergenic
1087684494 11:101248016-101248038 GCATTAAATGCCATAGTTTGAGG - Intergenic
1088071479 11:105791138-105791160 GTATTAAATGAGCCAATTTAGGG - Intronic
1088451649 11:109987682-109987704 AGATTGGATGAGACAGTTTGGGG + Intergenic
1091814539 12:3426618-3426640 GCATTAAATGCAATAGTTTGAGG + Intronic
1092851371 12:12630980-12631002 GAATTATATGACACAGTTCCAGG + Intronic
1093678587 12:21973555-21973577 GAATTAAATCAGAATGTCTGGGG + Intergenic
1094403352 12:30086434-30086456 GAATTAAATGAGACAATGTGTGG + Intergenic
1094403799 12:30093021-30093043 GAATTAAATAACTCAGTTTATGG + Intergenic
1095162377 12:38933371-38933393 GCATTAAATGTAATAGTTTGAGG + Intergenic
1096207698 12:49737242-49737264 GCATTAAATGCAATAGTTTGAGG - Intronic
1096967780 12:55642246-55642268 GGATTAAATAAGACAGTTACAGG - Intergenic
1097359032 12:58637356-58637378 GAATTAAATGAGATAGATTGTGG + Intronic
1097398942 12:59106662-59106684 GAATTAAGAGTGGCAGTTTGGGG - Intergenic
1097682554 12:62662413-62662435 GAATTATATCAGACAATTCGAGG + Intronic
1098026637 12:66210994-66211016 GAAGTAAATTAGGCAGTTAGAGG + Intronic
1098050610 12:66448635-66448657 GGAGCCAATGAGACAGTTTGTGG - Intronic
1098248369 12:68543688-68543710 GCATTAAATGCAATAGTTTGAGG - Intergenic
1098485091 12:71011432-71011454 TTATTGAATGAGTCAGTTTGTGG - Intergenic
1098744707 12:74221113-74221135 GTCTTAAAGGAGTCAGTTTGGGG - Intergenic
1098833579 12:75392568-75392590 GAATTCAATTATAGAGTTTGGGG + Intronic
1100561725 12:95754025-95754047 GAGTTAAGTGTGGCAGTTTGGGG - Intronic
1100943093 12:99746471-99746493 GAACTAAATGAGAATATTTGAGG - Intronic
1101194926 12:102372010-102372032 GAATTAAATGAAGTTGTTTGTGG - Intergenic
1101365488 12:104065837-104065859 GAATTAAATGATACAGATCAGGG + Intronic
1103013978 12:117479944-117479966 GATTAAAATGAGACAGTGCGTGG + Intronic
1103100233 12:118168123-118168145 AAATTAATGGAGACTGTTTGAGG + Intronic
1104212057 12:126698657-126698679 GGATTAAATTAGCCAGTGTGTGG - Intergenic
1105334043 13:19447629-19447651 GAATTATATAAGTCAGTTTACGG + Intronic
1106780313 13:33052563-33052585 CAATGAAATAAGATAGTTTGTGG - Intronic
1106789617 13:33141370-33141392 GGATTAAATGAGATAATGTGTGG + Intronic
1107219883 13:37969819-37969841 GAATTAACAGTGGCAGTTTGGGG + Intergenic
1107649155 13:42526841-42526863 TAATTAAATGAGAATTTTTGAGG + Intergenic
1107846695 13:44521530-44521552 ACATAAAATGAGTCAGTTTGGGG + Intronic
1108317720 13:49254076-49254098 GGATTAAATGAGATAATTTAGGG + Intronic
1108913047 13:55579088-55579110 GAGTTAAAAGTGACAGTTTGGGG + Intergenic
1108919174 13:55655794-55655816 GAGTTAATAGTGACAGTTTGGGG + Intergenic
1108998877 13:56769416-56769438 GAATTAAAAGTAACAGGTTGGGG + Intergenic
1109073512 13:57802719-57802741 TATTTAAATGATACAGTTTCAGG - Intergenic
1109241178 13:59890625-59890647 GAATTAAGTGAAGCAGTATGTGG - Intronic
1109369226 13:61399639-61399661 CAAATAAATAAGACAGTCTGAGG + Intergenic
1109489906 13:63083580-63083602 AAATCAATTGAGACAATTTGTGG - Intergenic
1109526898 13:63587225-63587247 TAATTAAATAAGACAGTTATTGG - Intergenic
1110653734 13:77972695-77972717 GCATTAAATGCAACAGTTTGAGG + Intergenic
1112331497 13:98480052-98480074 CAATTAAATGAGACGATTAGGGG + Intronic
1112686707 13:101837432-101837454 GAATAAAATGAGAGAATGTGTGG + Intronic
1113580613 13:111426096-111426118 TGGTTAAATGAGACAGTGTGTGG - Intergenic
1114311377 14:21470746-21470768 GAACTAAAAGGGAAAGTTTGAGG + Intronic
1114509243 14:23243328-23243350 GAATGGGATGAGACAGTTTGTGG - Intronic
1115331013 14:32198496-32198518 GCATTAAATGATACAGCTTTAGG + Intergenic
1115554120 14:34530777-34530799 GAATTAAAAAAAACAGTATGAGG + Intronic
1116536947 14:46043324-46043346 GTTTTAAATGACACAGTTTTTGG - Intergenic
1116701987 14:48256014-48256036 GAATTAAGAGTGGCAGTTTGGGG + Intergenic
1117518663 14:56528405-56528427 GAATAAAATGAGTCTTTTTGGGG + Intronic
1117955218 14:61117633-61117655 GCATTAAATGCAATAGTTTGAGG + Intergenic
1118948171 14:70408309-70408331 GAATTAAATGAGTTGTTTTGTGG + Intronic
1118979768 14:70707048-70707070 AATTCAAATGAGACAGTTTTAGG + Intergenic
1119165466 14:72488899-72488921 GATTTCAATGAGACAGGCTGGGG - Intronic
1119562793 14:75604375-75604397 GGATTCAATGAGACAATATGTGG + Intronic
1119576177 14:75724488-75724510 GCATTAAATGACAAAGTTTCGGG - Intronic
1119868827 14:77995625-77995647 GCATTAAATGAGATAGTCAGAGG - Intergenic
1120072938 14:80123566-80123588 GAATTAAAGGAGATTCTTTGGGG + Intergenic
1120177469 14:81310372-81310394 AAATTAAATGACCCATTTTGAGG - Intronic
1120261163 14:82188099-82188121 GAATAAAATTAGCCAGTTAGAGG - Intergenic
1120292119 14:82589042-82589064 GAAATAAATGACCCAGTCTGTGG + Intergenic
1120520539 14:85522656-85522678 AAATTAAATCATACAGTATGTGG + Intergenic
1121133108 14:91467821-91467843 CAATTAAATGTAACAGTTTGGGG - Intronic
1121990667 14:98553753-98553775 GGATTTAATGAGAGAGTTTGAGG - Intergenic
1122046316 14:99026507-99026529 GAAGGGAATAAGACAGTTTGGGG + Intergenic
1124100175 15:26685549-26685571 GAAAAAAATGAGATAGTTTTAGG + Intronic
1124244545 15:28058145-28058167 TAATGAAATGAGAGACTTTGGGG + Intronic
1124828115 15:33120052-33120074 CAATTAAATGACTCAATTTGAGG + Intronic
1125056607 15:35365881-35365903 AAACTAAATGAGACAACTTGGGG - Intronic
1125226150 15:37398580-37398602 GGACTAAATGAGACAGTGTATGG - Intergenic
1126684475 15:51235330-51235352 CTACTAAATGAGACAGTCTGGGG - Intronic
1126797721 15:52273823-52273845 GGATTAAATGAGAGAATATGAGG + Intronic
1126875067 15:53032498-53032520 GCATTATATGAGACAGGTAGTGG + Intergenic
1126983739 15:54277853-54277875 GAAAAAAATGATACAGTTGGGGG + Intronic
1127221095 15:56881979-56882001 GAATTAACTGAGAAAGTTCATGG + Intronic
1127594949 15:60471476-60471498 TAATTAAATTTGCCAGTTTGTGG - Intronic
1127928761 15:63575879-63575901 TTATAAAATGATACAGTTTGAGG - Intronic
1128027895 15:64454200-64454222 GACTTAGATGAGACTTTTTGTGG + Intronic
1128115030 15:65099939-65099961 GACTTAAATAAGACAATGTGAGG + Intronic
1128698982 15:69790105-69790127 GAATTAGATGAGAGTGTTTTTGG + Intergenic
1128958870 15:71978674-71978696 GAATTTAATGAAACAATTTCTGG + Intronic
1129824019 15:78622428-78622450 AAACAAAAGGAGACAGTTTGTGG + Intergenic
1130878513 15:88034488-88034510 GAATTAGCTGTGACTGTTTGTGG + Intronic
1131775475 15:95792240-95792262 GAATTATATGGCACAGCTTGAGG + Intergenic
1131794135 15:95996435-95996457 GAAATGAATGAAACAGCTTGGGG - Intergenic
1131840670 15:96433399-96433421 GAATTAAATAAGATAATTTATGG - Intergenic
1132168825 15:99626269-99626291 GAAATAAATGAGACTGTAAGAGG - Intronic
1133350922 16:5099655-5099677 GATTTAAATGAAAGTGTTTGGGG - Intergenic
1134045484 16:11098060-11098082 CAATTAAATCAGACTGTCTGGGG + Intronic
1134915833 16:18070084-18070106 GAATTACATGAGCGAGTTTTGGG - Intergenic
1135650203 16:24199704-24199726 GAATTAAATGAGGCAATTCATGG - Intronic
1138774497 16:59705124-59705146 CCATTAAATGGGACATTTTGAGG - Intergenic
1138891101 16:61145066-61145088 GAATTAATTGTGCCAGTTTAGGG + Intergenic
1139156489 16:64449239-64449261 GGATTAAATGAGACACTGGGTGG + Intergenic
1139262979 16:65612917-65612939 CAATTAAATCAGAAGGTTTGAGG + Intergenic
1139389082 16:66594369-66594391 AATTTAAGTGATACAGTTTGTGG + Intergenic
1140866832 16:79069700-79069722 CAATTAAATGAGGCAGTGTGTGG + Intronic
1144349826 17:14384458-14384480 TAATTGAATGAGACAGAGTGGGG + Intergenic
1146095536 17:29926733-29926755 GAATTAAATAGACCAGTTTGAGG - Intronic
1146645062 17:34571833-34571855 GAATTAAATGAAGCTGTATGGGG + Intergenic
1146764134 17:35504086-35504108 GCATTAAATGCAATAGTTTGAGG - Intronic
1147025412 17:37578446-37578468 GAATTCTATGAGACAGTAGGTGG + Intronic
1147810332 17:43164469-43164491 GCATTAAATGCAATAGTTTGAGG + Intergenic
1148076318 17:44937613-44937635 GAAATTAATAAGAGAGTTTGGGG - Intronic
1150042355 17:61877482-61877504 CAATTAAATCAGACTGTTTGTGG - Intronic
1150332091 17:64302534-64302556 CAATTAAATGAGAATGTTTGAGG + Intergenic
1150887804 17:69108010-69108032 AGATGAAGTGAGACAGTTTGAGG - Intronic
1152124696 17:78439252-78439274 TAATTAAATGACACAGGTTCAGG + Intronic
1152454923 17:80409226-80409248 GCATTAAATGCAATAGTTTGAGG - Intergenic
1153555712 18:6311080-6311102 GAATTGATTGAGGCAGGTTGTGG - Intronic
1153826406 18:8878965-8878987 GTATTAAATGCAATAGTTTGAGG + Intergenic
1153828321 18:8897647-8897669 GACTTGAACTAGACAGTTTGGGG + Intergenic
1153830361 18:8917127-8917149 GTATTAAATGCAATAGTTTGAGG - Intergenic
1154474480 18:14742693-14742715 TAATTAAATAAAATAGTTTGAGG + Intronic
1155579864 18:27291503-27291525 GAATTAAGTGGGACAGTTAATGG - Intergenic
1157085070 18:44572120-44572142 GAATGGAATAAGACAGTTTTAGG - Intergenic
1157114288 18:44848620-44848642 GGAAGAAATGAGACAGTTGGGGG - Intronic
1157914464 18:51651312-51651334 GAATGAAATGAGAGAGTTACAGG - Intergenic
1158394203 18:57067028-57067050 GAATTAAGAGTGGCAGTTTGGGG + Intergenic
1159098084 18:63928148-63928170 AAATTATAAGAGACAGCTTGTGG - Intronic
1159283893 18:66324158-66324180 GTATTTAATGAGGCACTTTGTGG + Intergenic
1159690462 18:71481438-71481460 GAAGTATATGAGACAATATGAGG + Intergenic
1159706348 18:71693287-71693309 GAAAGAAATTAGACAGCTTGGGG + Intergenic
1159835419 18:73329507-73329529 GAGTTAAGTGTGGCAGTTTGGGG - Intergenic
1162267839 19:9590365-9590387 GCATTAAATGCAACAGTTTGAGG + Intergenic
1162281874 19:9705263-9705285 GTATTAAATGCAATAGTTTGAGG - Intergenic
1163867114 19:19782757-19782779 GCATTAAATGCAATAGTTTGAGG + Intergenic
1163991823 19:21006093-21006115 GCATTAAATGCAATAGTTTGAGG - Intergenic
1164130748 19:22359057-22359079 GCATTAAGTGCAACAGTTTGAGG + Intergenic
1164450601 19:28360274-28360296 TAATTAAATTTGACAGTGTGAGG + Intergenic
1166804724 19:45478877-45478899 TATGTAAATGAGACGGTTTGGGG - Intergenic
1166811064 19:45515008-45515030 GAATAAAATGAGTGACTTTGGGG + Intronic
1167693037 19:50998982-50999004 GCTTTGGATGAGACAGTTTGCGG - Intronic
925250227 2:2427867-2427889 GAATTAATAGATACATTTTGGGG - Intergenic
925511762 2:4635211-4635233 GAAGTAAATGAGGCATTTTCTGG + Intergenic
925544921 2:5005846-5005868 GAGTTAAAAGTGGCAGTTTGGGG - Intergenic
926580310 2:14627520-14627542 GTATTAAATTAGACAATGTGTGG - Intergenic
926674463 2:15609041-15609063 GAATTAAGTGTGAAAGTGTGGGG + Intronic
927568170 2:24133047-24133069 GAATTAGAAGACAGAGTTTGGGG - Intronic
929410600 2:41694296-41694318 AAATTAAATCAGAGTGTTTGTGG - Intergenic
929816856 2:45239240-45239262 GGATTAAATGAGATAATATGTGG - Intergenic
932203341 2:69853206-69853228 GAATTAAATGTGCCAATTTCAGG - Intronic
933056591 2:77677702-77677724 AAATTAAATGAGATAGTATGTGG - Intergenic
933142096 2:78804207-78804229 GAATTAAATGGAACAGTTGAAGG - Intergenic
933394633 2:81715365-81715387 GAATTAATTGAGATATTTGGAGG + Intergenic
933639396 2:84743037-84743059 CAGTTAAATGAGACAGCTAGAGG + Intronic
933766815 2:85714881-85714903 GAATGAAATGACACTATTTGAGG - Intergenic
933926667 2:87098506-87098528 AAATTAAATGCGATAGTATGTGG - Intergenic
934928328 2:98397717-98397739 GACTTACACAAGACAGTTTGAGG + Exonic
935048330 2:99502074-99502096 GCATTAAATGCAACAGTTTGAGG - Intergenic
935327690 2:101952334-101952356 GAATTAAATCATACAAATTGTGG + Intergenic
935721510 2:105983376-105983398 GCATTAAATGCAATAGTTTGAGG + Intergenic
935970558 2:108527186-108527208 GCATTAAATGCAATAGTTTGAGG - Intergenic
936046617 2:109193491-109193513 GAATGGAATCATACAGTTTGCGG + Intronic
936109825 2:109655784-109655806 GTATTAAATGAGGAAGCTTGTGG + Intergenic
936419621 2:112350704-112350726 GCATTAAATGCAATAGTTTGAGG + Intergenic
936869666 2:117120396-117120418 GAATCAAATGAGATAGATTTTGG - Intergenic
937207047 2:120243495-120243517 GACTCCAATGAGACAGTGTGTGG - Intronic
937540311 2:122942525-122942547 GAATGAAATGAGAAAGAGTGTGG + Intergenic
938703136 2:133897236-133897258 GCATTAAATGCAATAGTTTGAGG - Intergenic
939005054 2:136777286-136777308 GTATTAAATGGGAAAGTTTTGGG - Intronic
939032334 2:137091975-137091997 GTATTAGATGAGACATTTTCAGG + Intronic
939452785 2:142395589-142395611 GAATTAAATGAGGCTGCTGGTGG - Intergenic
939617026 2:144373161-144373183 GAATCAAATGAGACAATATATGG - Intergenic
940452807 2:153861206-153861228 GAATTAAATAATGCAGTTTATGG - Intergenic
941616906 2:167730917-167730939 GAATTAACTGAGATAGTATTTGG - Intergenic
942333540 2:174854686-174854708 GAATCAAATGAGATACTATGTGG + Intronic
942664611 2:178304213-178304235 GAATTGACTGATACAGCTTGTGG - Intronic
942853296 2:180516716-180516738 GCATAAAATGAGGCAGTCTGAGG - Intergenic
943406163 2:187490133-187490155 AAAATAAATAAGTCAGTTTGAGG - Intronic
943408060 2:187513849-187513871 GCATTAAATGCAATAGTTTGAGG - Intronic
943566683 2:189524592-189524614 CAATTAAATCAGACGATTTGGGG - Intergenic
943806154 2:192129256-192129278 TATTTAAATGAGATAGTTAGTGG - Intronic
944158393 2:196633482-196633504 GAATGAAATGACACACTTTGAGG - Intergenic
944251704 2:197585420-197585442 GACTTAAAAGTGGCAGTTTGAGG - Intronic
944324363 2:198386551-198386573 GAAATACATGAAACAGTTAGGGG - Intronic
944860121 2:203807958-203807980 CAACTAAATCAGACACTTTGAGG + Intergenic
945289711 2:208115250-208115272 GCATTAAATGCAATAGTTTGAGG - Intergenic
945354405 2:208821493-208821515 TAATTTGATTAGACAGTTTGTGG - Intronic
945619626 2:212118109-212118131 GAATTAAATCCAACAGTGTGGGG - Intronic
946567081 2:220978299-220978321 GGATTAAATGAGATAATTTGTGG + Intergenic
948473039 2:238197851-238197873 GAATTAAATGAGAAGATGTGTGG - Intronic
1169538915 20:6579052-6579074 AAATTCAATCAGACATTTTGAGG + Intergenic
1169797405 20:9478561-9478583 AAACTAAATCAAACAGTTTGTGG + Intronic
1169960460 20:11153513-11153535 GAATTCAGTGATACAGTTTCTGG - Intergenic
1170054503 20:12185527-12185549 GTTTTAAATGACCCAGTTTGTGG + Intergenic
1170950139 20:20929286-20929308 GAATTAAACGAAAGACTTTGTGG + Intergenic
1171507262 20:25647831-25647853 GAAGCAAATGATACAGTATGAGG - Intergenic
1174119526 20:48252145-48252167 CAATTAAATGAGATAATATGAGG + Intergenic
1174331418 20:49822087-49822109 GGATTAAATGAGAGAGTATTTGG + Intronic
1175049212 20:56137747-56137769 GAATGGAATGATACAGTATGAGG + Intergenic
1175264080 20:57692154-57692176 GAATTAAATGAGACAGTTTGTGG - Intronic
1175585226 20:60133856-60133878 TCTTTAAATGAGACACTTTGGGG + Intergenic
1175922237 20:62455675-62455697 GAATTATCTGAGAGACTTTGGGG - Intergenic
1177918332 21:27119460-27119482 GAATTAATTCAGAAAATTTGAGG - Intergenic
1178032609 21:28545174-28545196 GAATTAAATGATATTGTTTACGG + Intergenic
1178669175 21:34575844-34575866 GGATTAAATGACACCTTTTGGGG - Intronic
1178962462 21:37078364-37078386 GAATTAATTGAATCAGTTTGGGG + Intronic
1179670912 21:42947024-42947046 GAATTAAATGCAATAGTTTGAGG + Intergenic
1180437805 22:15329564-15329586 TAATTAAATAAGACATTTTTTGG - Intergenic
1181165043 22:20978776-20978798 GATTTAACTGAGAGAGTTTAGGG + Intronic
1182626482 22:31650590-31650612 GAGTTAAATGAGTTAGTATGTGG - Intronic
1182732649 22:32507639-32507661 GAGTTAAAAGTGGCAGTTTGGGG - Intergenic
949213244 3:1532214-1532236 GAAGTAAATCAGAGAGCTTGTGG + Intergenic
949236564 3:1816231-1816253 CAATTAAAATAGACAGTTTTTGG + Intergenic
949314879 3:2741786-2741808 TAATTAAAGGTCACAGTTTGGGG - Intronic
949671608 3:6402987-6403009 GAATTAAGAGTGGCAGTTTGGGG - Intergenic
950205699 3:11078772-11078794 GAATGGAATCATACAGTTTGTGG + Intergenic
951219610 3:20055443-20055465 GAATTAAATGAGAATGCCTGGGG + Intronic
951766749 3:26208134-26208156 GCATAAAATGTGACAATTTGAGG - Intergenic
951866914 3:27318809-27318831 GACTTAAAGGGGAAAGTTTGAGG + Intronic
952698583 3:36299778-36299800 GAATTAAATAAGATACTTTATGG + Intergenic
956172119 3:66441233-66441255 GAAATAAAGGTGCCAGTTTGTGG - Intronic
956215235 3:66842052-66842074 GAATTCAATGAGACAATTCATGG - Intergenic
956410686 3:68975350-68975372 GAATTTTATGAGACTTTTTGTGG - Exonic
956869575 3:73403419-73403441 GGATTAAATGAAACAATATGTGG - Intronic
956878310 3:73485750-73485772 CAATTAAATAAGACAATTTCAGG + Intronic
957055175 3:75436998-75437020 GATTTAAATGAAAGTGTTTGGGG - Intergenic
957215450 3:77314784-77314806 GAATTGAATGAAACAATTTTGGG - Intronic
957999946 3:87737841-87737863 GCATTAAATGCAATAGTTTGAGG + Intergenic
958493632 3:94812727-94812749 TATTTAAATGATATAGTTTGAGG - Intergenic
958655374 3:96995274-96995296 GCATTAAATAAGGGAGTTTGAGG + Intronic
960496043 3:118376357-118376379 GAAATACATGAAACTGTTTGTGG - Intergenic
960555949 3:119030870-119030892 GAATTATTTTAGGCAGTTTGGGG - Intronic
960720380 3:120619377-120619399 GCATTAAATGTAATAGTTTGAGG + Intergenic
961974338 3:131007112-131007134 AAATTAAATGTCAAAGTTTGGGG + Intronic
962277044 3:134023348-134023370 GCATTAAATGCAATAGTTTGAGG - Intronic
963151871 3:142053135-142053157 CAATTAAAAAAGATAGTTTGTGG - Intronic
964030802 3:152136749-152136771 GAAATTAATGAGCCATTTTGGGG - Intergenic
966423013 3:179752461-179752483 GAATGAAATGGAACTGTTTGTGG - Intronic
967677016 3:192312479-192312501 GAAATAACTAAGAAAGTTTGTGG + Intronic
968997993 4:3957308-3957330 GATTTAAATGAAAGGGTTTGGGG - Intergenic
969139208 4:5054132-5054154 GAAATAAATGAGTCGGTTGGTGG - Intronic
970708070 4:18829348-18829370 GAAAAAAATGAGACATTTGGAGG - Intergenic
970991688 4:22220365-22220387 GAATTAAATCACCCAGTCTGGGG + Intergenic
971676753 4:29641273-29641295 GCATAAAATGAGAAAGTTGGTGG + Intergenic
972157941 4:36188066-36188088 AATTAAAATGATACAGTTTGAGG - Intronic
972217030 4:36909093-36909115 GCATTAAATGCAATAGTTTGAGG - Intergenic
972991247 4:44824382-44824404 GCATTAAATGCAATAGTTTGAGG + Intergenic
973121289 4:46523425-46523447 GCATTAAATGTTGCAGTTTGGGG - Intergenic
974346045 4:60682588-60682610 TAATTTAATGAGACAGTCAGGGG + Intergenic
974773822 4:66453187-66453209 GAAGTAAATGAGATATTGTGTGG + Intergenic
975070439 4:70130750-70130772 AATTTAAATGAGACAATTTTAGG - Intergenic
975933183 4:79552131-79552153 TAAATAAATGCCACAGTTTGAGG + Intergenic
975959382 4:79882817-79882839 GAAATAAATGAGATTGTTTTAGG - Intergenic
976038017 4:80847703-80847725 AAATTAAATGAGAAAATTTCTGG + Intronic
976070506 4:81234792-81234814 GAATTAAAAGAGAAAATTAGAGG - Intergenic
976542936 4:86298686-86298708 GAATTAATTCAGACAGTCAGTGG + Intronic
977043595 4:92042675-92042697 GCATTAAATGCAATAGTTTGAGG + Intergenic
977356724 4:95955149-95955171 GCTTTAAATCAGACATTTTGAGG + Intergenic
977417726 4:96755928-96755950 GAATGAAATCAGACAGTGTTTGG + Intergenic
977964797 4:103132800-103132822 GAAAGAAATGACACAGTTTTTGG - Exonic
977972352 4:103227168-103227190 GCATTAAATGCAACAGTTTGAGG - Intergenic
978053385 4:104232315-104232337 AATTTTAATGAGACAGTTTTTGG - Intergenic
978314154 4:107417504-107417526 GCATTAAATGCAATAGTTTGAGG - Intergenic
978401878 4:108339961-108339983 GAATTAAATGGGATAGTTCACGG + Intergenic
978563228 4:110055197-110055219 AAATTAAATGTGACATTATGTGG - Intronic
979074958 4:116259565-116259587 GAATTTAATGTTACAGCTTGAGG + Intergenic
979339527 4:119504820-119504842 GAGCTAAATGAGGCAGTTTGAGG - Intronic
980204908 4:129705138-129705160 GAATTCAAAGAGGCAGTCTGAGG + Intergenic
981330997 4:143510205-143510227 AAATTAAATGAGACAGTATAAGG - Intergenic
983708351 4:170686099-170686121 GCATTAAATGCAATAGTTTGAGG - Intergenic
983887643 4:172998443-172998465 GAATTAAAATAAACATTTTGGGG - Intronic
984320735 4:178192448-178192470 GAAATTAATGATACAGTTTAAGG + Intergenic
986820073 5:11457059-11457081 AAATTAAATGAGACAATATACGG - Intronic
986822733 5:11485413-11485435 GAATTAAAATAGATATTTTGGGG - Intronic
987467386 5:18288253-18288275 GACTTAAATGTGTCATTTTGAGG + Intergenic
987559757 5:19504875-19504897 GAGTTAACTGAGCCAGTTTATGG + Intronic
987930562 5:24395097-24395119 GCATTAAATGCAATAGTTTGAGG + Intergenic
988178690 5:27761574-27761596 GAATTAAAGAATACAATTTGGGG + Intergenic
988410130 5:30876095-30876117 CAATTGAGTGAGACAGTTTTTGG - Intergenic
989096067 5:37782352-37782374 GCATTAAATGCAATAGTTTGAGG + Intergenic
989269458 5:39515038-39515060 GGATTAATTGAGATAATTTGGGG - Intergenic
989772521 5:45161744-45161766 GAGCTAAAAGAGACAGTTTATGG - Intergenic
990691668 5:58370962-58370984 GAATGAAAGCAGACATTTTGTGG + Intergenic
991287406 5:64993119-64993141 GAATTAAATGAGATAATTCATGG + Intronic
991306053 5:65177357-65177379 GCATTAAATGCAATAGTTTGAGG - Intronic
993045678 5:82863588-82863610 GTGTAAAATGAGTCAGTTTGAGG - Intergenic
993112066 5:83669799-83669821 GAATTAAATGAGATAATATGTGG - Intronic
993392213 5:87333842-87333864 GAATTAAATGAGAGAATTAATGG - Intronic
993411799 5:87583309-87583331 GACTTAAATTATACAGTTTTTGG - Intergenic
993555056 5:89326141-89326163 GAACTAAATGAAGCAGTGTGAGG - Intergenic
993795533 5:92261977-92261999 GAATGCATTGAGAGAGTTTGAGG - Intergenic
994313436 5:98304031-98304053 GAAATAAAGAAGACAGCTTGAGG + Intergenic
994812005 5:104531822-104531844 GAAGAAGATGAGATAGTTTGTGG + Intergenic
995294071 5:110498248-110498270 GAATTAAATGAGGCAGCTACAGG - Intronic
995867403 5:116706439-116706461 GCATTAAATGCAACAGTTTGAGG - Intergenic
996351952 5:122553763-122553785 GTCTTAAATGGCACAGTTTGTGG - Intergenic
997399541 5:133591677-133591699 AACTCAAATGAGACAGTCTGGGG + Intronic
997756473 5:136404364-136404386 GAATTAAATGAGATAATGTATGG + Intergenic
997918479 5:137953365-137953387 GAAGAAAATCAGACAATTTGAGG - Exonic
998552509 5:143090989-143091011 GCATTAAATGCAATAGTTTGAGG + Intronic
998754871 5:145366199-145366221 GAATAAACTGAGAGAATTTGTGG - Intergenic
1000079062 5:157827493-157827515 GAATTAAATGACAGACTTTAAGG - Intronic
1000251408 5:159499113-159499135 GAATTAAATGAGACAGTTTGAGG + Intergenic
1000918924 5:167115905-167115927 GAAATAACTGAGAAATTTTGAGG + Intergenic
1001154676 5:169262714-169262736 GAATTAAATGAGGCAAGCTGAGG - Intronic
1001379866 5:171297824-171297846 GAATTTATTGGGTCAGTTTGAGG - Intronic
1001404024 5:171462914-171462936 GAATTAAGTGAGAGAATTGGGGG - Intergenic
1001558464 5:172652773-172652795 GCATTAAATGCAATAGTTTGAGG + Intronic
1002941092 6:1716789-1716811 TAATTAAAAGAGAGAGTTGGGGG - Intronic
1002999141 6:2314665-2314687 GCATTAAATGCAATAGTTTGAGG + Intergenic
1003181155 6:3792979-3793001 GAATTAAATGAGATAGCTGCAGG - Intergenic
1003377826 6:5595484-5595506 GACTTGAATGAGAAAGTCTGTGG - Intronic
1006565124 6:34949636-34949658 GAAGTCAATGAGTCAATTTGAGG - Intronic
1006817575 6:36863061-36863083 GAATTAAATGAGACAGCATATGG + Intronic
1007131988 6:39483806-39483828 AAATGAAATGAGACAGGTTCTGG + Intronic
1008123448 6:47643899-47643921 GCATTAAATGCAATAGTTTGAGG - Intergenic
1008900095 6:56603563-56603585 GAATCAACTTAGACAGTTGGAGG - Intronic
1009343767 6:62589374-62589396 GAATTAAGAGTGGCAGTTTGGGG - Intergenic
1009635744 6:66262427-66262449 GCATTAAATGCAATAGTTTGAGG - Intergenic
1011807047 6:91083582-91083604 TAATTAAATGAGAGAGGGTGGGG - Intergenic
1012226284 6:96706613-96706635 GAATAAAATTAGTGAGTTTGGGG + Intergenic
1012243324 6:96898143-96898165 GAATTAAATCAGAAAGTCTGGGG - Intergenic
1012508491 6:99975961-99975983 GAATTGAATCTCACAGTTTGAGG + Intronic
1012822742 6:104107619-104107641 GAATTTTATGATACAGTGTGAGG + Intergenic
1012986655 6:105883374-105883396 GATATAAATGAGATAGTATGAGG + Intergenic
1013198592 6:107868187-107868209 GAGTTAAATCAGACCGTTTGTGG + Exonic
1013559534 6:111290643-111290665 GAATTAAGGGAGATAGTTTAGGG - Intergenic
1013650998 6:112194315-112194337 GAATTAAATGAAAAAGTTACTGG - Intronic
1013825005 6:114201188-114201210 GAAATAGAGGAGATAGTTTGAGG - Intronic
1014075163 6:117227156-117227178 GAATTAAATGAGAATGTTATGGG + Intergenic
1014551764 6:122797191-122797213 GAATAAAATTATCCAGTTTGTGG + Intronic
1014870719 6:126593438-126593460 GAGTTAAATGAGATAGTGTATGG - Intergenic
1016238892 6:141904818-141904840 GAATTAAATGAGATATTTATTGG - Intergenic
1016267447 6:142248823-142248845 AAATTAAATGAAATATTTTGTGG - Intergenic
1016961343 6:149675376-149675398 GTATTAAATCAGACAGTGTATGG + Intronic
1017673468 6:156790385-156790407 AAATTAATTAAGATAGTTTGTGG + Intronic
1017891135 6:158640345-158640367 GAATTTAATGATACTGTTTGGGG - Intronic
1018480565 6:164185358-164185380 CAATTAAATGTGACAGTTGAGGG + Intergenic
1019131669 6:169881549-169881571 GGATTAAATGAGTACGTTTGAGG - Intergenic
1020043919 7:5025446-5025468 GCATTAAATGCAATAGTTTGAGG + Intronic
1020745405 7:12072991-12073013 GAATCAAATGTAATAGTTTGAGG - Intergenic
1020893834 7:13914534-13914556 TAATCAAATTAGATAGTTTGGGG - Intronic
1021961333 7:25875971-25875993 GTTTTAAATGACCCAGTTTGAGG - Intergenic
1023799480 7:43821534-43821556 GCATTAAATGCAATAGTTTGAGG - Intergenic
1025252267 7:57359590-57359612 GAATTAAATCAGAAAATATGGGG + Intergenic
1025796844 7:64746034-64746056 GAATTAAATGAGCTTTTTTGTGG - Intergenic
1027520371 7:79199089-79199111 TCATTAAATTAGATAGTTTGTGG - Intronic
1027542789 7:79489124-79489146 GAAGTCAAAGAGACAGTTTTGGG + Intergenic
1028092083 7:86715439-86715461 GAACTAAATGAGGCATTTTAAGG + Intronic
1028333956 7:89628587-89628609 GCATTAAATGCAATAGTTTGAGG - Intergenic
1029822001 7:103155682-103155704 GCATTAAATGCAATAGTTTGAGG - Intergenic
1030682219 7:112445982-112446004 CATTTAAATCAGACAATTTGGGG + Intronic
1031586556 7:123537650-123537672 GAATTACATGAGGCTATTTGTGG - Exonic
1031843782 7:126779965-126779987 GGATTAAATGAGACAATGTAAGG + Intronic
1032170528 7:129580953-129580975 GCATTAAATGTAATAGTTTGAGG - Intergenic
1032412705 7:131709814-131709836 AAATCAAATGAGAAATTTTGTGG - Intergenic
1032480025 7:132238921-132238943 GAATCAAATGAGATGGTATGAGG - Intronic
1033019348 7:137707059-137707081 AAATCAAATGAGACTGTTAGGGG - Intronic
1035115655 7:156521106-156521128 GACATAAATCACACAGTTTGGGG + Intergenic
1036379254 8:8226651-8226673 GATTTAAATGAAAGGGTTTGGGG + Intergenic
1036424790 8:8634803-8634825 AAATGAAATCAGACATTTTGTGG + Intergenic
1036522022 8:9500727-9500749 GAATTAACTGAAACAGTTGTTGG + Intergenic
1037751129 8:21683143-21683165 GAATTAAATTAGACAGTGGCAGG - Intergenic
1038089639 8:24239041-24239063 GCATTAAATGCAATAGTTTGAGG - Intergenic
1038388254 8:27169813-27169835 AAATTACATGGGACAGTTTTTGG - Intergenic
1038543196 8:28406069-28406091 GAATTAAATGAGGCAGTATGTGG + Intronic
1039194655 8:35017551-35017573 GAAAGAAATGAGAAATTTTGAGG + Intergenic
1039773432 8:40712220-40712242 GAATTAAATGAGTTTGTATGTGG + Intronic
1040584792 8:48728628-48728650 GGATTAAATGAGGCAATATGAGG + Intronic
1040678549 8:49781670-49781692 GTATTTAATGTTACAGTTTGAGG + Intergenic
1040993417 8:53376336-53376358 GCATTAAATGCAATAGTTTGAGG + Intergenic
1041227118 8:55711763-55711785 GCATTAAATGCAATAGTTTGAGG - Intronic
1041515442 8:58694574-58694596 GCATTAAATGCAATAGTTTGAGG - Intergenic
1041970028 8:63729896-63729918 GAATTAAGTAAGACTGTTTTCGG - Intergenic
1041983483 8:63891861-63891883 TAATAAAAAGAGACAATTTGAGG - Intergenic
1042412812 8:68483734-68483756 AAATTAAATGACACAGATGGAGG + Intronic
1042413160 8:68487546-68487568 GAAATAGATGAGAAAGTTTAAGG - Intronic
1042447350 8:68901521-68901543 GAACTAAATGACATAATTTGTGG - Intergenic
1043521528 8:81051338-81051360 GAAATTTATGTGACAGTTTGGGG - Intronic
1043775101 8:84256939-84256961 GGATTAAATGAGATAATTTCTGG + Intronic
1044783771 8:95772841-95772863 GAATTAAATCAGAGACTTTAGGG - Intergenic
1044916158 8:97114448-97114470 GGATTAAGTGAGACAATATGTGG + Intronic
1044925532 8:97205788-97205810 GAGTTAAGTGTGGCAGTTTGGGG - Intergenic
1046011644 8:108555874-108555896 AAATTAAACCAGGCAGTTTGGGG + Intergenic
1046350069 8:112997948-112997970 GAATGAAATGAGACATATAGAGG - Intronic
1046603413 8:116343880-116343902 AAAATAAAGGAGCCAGTTTGAGG - Intergenic
1046693484 8:117312152-117312174 CAATTAAATCAGAAATTTTGTGG - Intergenic
1047216431 8:122879916-122879938 GGATTAAATGAGAGAGTTCTAGG - Intronic
1047620766 8:126605085-126605107 GAAATAAATGAAACAGTGTCTGG - Intergenic
1048008902 8:130441088-130441110 GAATTAAAAGAGAAAGTGTGAGG + Intronic
1048129943 8:131684671-131684693 GAATTGAATGAGAAAATGTGGGG - Intergenic
1050251564 9:3750126-3750148 AAATTAAATCATACTGTTTGTGG + Intergenic
1050252573 9:3760676-3760698 GGTTTAAATGAGAAAATTTGGGG - Intergenic
1050317057 9:4413250-4413272 GAATTAAATGAGATTGTATATGG + Intergenic
1051937116 9:22456753-22456775 CAATTAACTGAGACACTTTCAGG - Intergenic
1051969651 9:22872438-22872460 GGACTTAATGAGACAGTGTGAGG + Intergenic
1052492284 9:29185147-29185169 GAGGTAAATGAGACACTCTGTGG - Intergenic
1052508064 9:29380626-29380648 GCATTAAATGCAATAGTTTGAGG - Intergenic
1052791940 9:32883390-32883412 GAATTAAATGAGACATATGTAGG + Intergenic
1052882076 9:33607546-33607568 AAATTCAATGAGCCTGTTTGTGG - Intergenic
1053179229 9:35953990-35954012 GAAATAAATGTGAAAATTTGGGG - Intergenic
1053494236 9:38538215-38538237 AAATTCAATGAGCCTGTTTGTGG + Intergenic
1053705530 9:40749297-40749319 GCATCAAATGTAACAGTTTGAGG + Intergenic
1054415607 9:64872904-64872926 GCATCAAATGTAACAGTTTGAGG + Intergenic
1054709240 9:68494554-68494576 GAATTAAATCACAATGTTTGGGG + Intronic
1054725774 9:68648533-68648555 GATTTAAATGAGAGAGAATGAGG - Intergenic
1055146998 9:72948024-72948046 GAATTAAGTGAGGTAATTTGTGG - Intronic
1055648928 9:78388195-78388217 GAATTTAATGTTACAGCTTGGGG + Intergenic
1055848943 9:80601891-80601913 GAATTAAATAGGAGAGATTGAGG - Intergenic
1056460187 9:86801797-86801819 GAAGTAAATGAGACTGTTTGAGG + Intergenic
1057544322 9:96006046-96006068 GTATTAAATGTGACATTCTGTGG + Intronic
1057978125 9:99628670-99628692 GAAGTTCATGAGAGAGTTTGTGG + Intergenic
1058075048 9:100642495-100642517 GAATTAAGGGAGATAGTTTGGGG + Intergenic
1058250150 9:102683954-102683976 TAATTAAATTAGATAGCTTGTGG - Intergenic
1059054997 9:110970090-110970112 TAATTAAATGAGTCATTTAGAGG + Intronic
1059405782 9:114097840-114097862 GAATTAAATGAGCCATTGTTTGG - Intronic
1059624330 9:116045148-116045170 AAATTAAATAATACAGTATGTGG + Intergenic
1059889627 9:118786922-118786944 TAATTAACTCACACAGTTTGGGG + Intergenic
1060028893 9:120197319-120197341 GAATTAAATGATGCATGTTGTGG - Intergenic
1060190713 9:121590606-121590628 GAATTAAATGAGAGAGCATCTGG + Intronic
1060485623 9:124044743-124044765 GAATTAAGTGAGACATTTCGAGG - Intergenic
1060486525 9:124051068-124051090 GTATTAAATGAGACAGTGAGTGG - Intergenic
1060581816 9:124754857-124754879 GAATGAAATGAGGTAGTTTATGG - Intronic
1060719916 9:125969909-125969931 GCATTAAATGAGATACTGTGTGG - Intergenic
1060906903 9:127314834-127314856 CACTTAGATGAGACAGTTTAGGG + Intronic
1186116694 X:6311358-6311380 AGATTAAATGAGCCAGTTTATGG + Intergenic
1186822273 X:13302698-13302720 GAAAGAAATGAGAGAGTTGGGGG - Intergenic
1186859534 X:13658053-13658075 GAATAAAATCATACAGTATGTGG - Intronic
1187147909 X:16654583-16654605 GAATTAAACCAGAGACTTTGGGG - Exonic
1187155072 X:16714247-16714269 CCAGGAAATGAGACAGTTTGGGG + Intergenic
1187684009 X:21798442-21798464 GAATTAAATGACATAATTTATGG + Intergenic
1188122414 X:26324911-26324933 GAATTCAATGAGAATGTGTGTGG + Intergenic
1189034541 X:37482395-37482417 GCATTAAATGCAATAGTTTGAGG - Intronic
1189051913 X:37654363-37654385 AAATTAAATGTGTCAGTTTTAGG + Intronic
1189171228 X:38911666-38911688 GAATCAAATGAGATAGTTGAGGG - Intergenic
1190112284 X:47599691-47599713 AATAAAAATGAGACAGTTTGTGG + Intronic
1190118419 X:47640634-47640656 GAATTTAAGAAGACAGTGTGTGG + Intronic
1190387124 X:49893148-49893170 GAATTATTTCACACAGTTTGTGG + Intergenic
1190771197 X:53516171-53516193 GCATTAAATGCAATAGTTTGAGG - Intergenic
1191958609 X:66674128-66674150 GAAGTAAAAGAGACAGTATGTGG - Intergenic
1191958796 X:66676431-66676453 GAATTAAATAAGACAGGTATAGG + Intergenic
1192915492 X:75646908-75646930 GCATTAAATGCAATAGTTTGAGG + Intergenic
1193049437 X:77084854-77084876 GCATTAAATTATATAGTTTGGGG - Intergenic
1193303587 X:79922667-79922689 GAAATACAAAAGACAGTTTGAGG + Intergenic
1193588206 X:83353906-83353928 AAATTAAATGAGATAATATGTGG - Intergenic
1193717306 X:84948181-84948203 GCATTAAATGCAATAGTTTGAGG - Intergenic
1193942107 X:87688909-87688931 GCATTAAATGAGACAATGTAAGG + Intergenic
1194541639 X:95179270-95179292 GAAGTAAATAAGACAATTAGAGG - Intergenic
1196460044 X:115920267-115920289 GCATTAAATGCAATAGTTTGAGG - Intergenic
1196869384 X:120098494-120098516 GCATTAAATGCAATAGTTTGAGG - Intergenic
1196976465 X:121163230-121163252 GAATTAAAGGAGATAATATGAGG - Intergenic
1197573302 X:128177175-128177197 AAAATAAATGACACATTTTGAGG - Intergenic
1197609369 X:128621976-128621998 AAATTAAGAGAGACAGATTGAGG - Intergenic
1198076398 X:133197618-133197640 AAATTAAAGGTGACAGATTGAGG + Intergenic
1198742448 X:139855685-139855707 GCATTAAATGCAATAGTTTGAGG - Intronic
1198751733 X:139942910-139942932 GAATCAAAGAATACAGTTTGAGG + Intronic
1199008110 X:142726472-142726494 CAATTAAATTAGACTATTTGAGG + Intergenic
1199276378 X:145948278-145948300 GAATTAAATGAGGCAGGATAGGG + Intergenic
1200330730 X:155294155-155294177 AAATTTATTGAGACATTTTGTGG - Intronic
1200763291 Y:7059254-7059276 GCATTAAATGCAATAGTTTGAGG + Intronic
1200769218 Y:7108172-7108194 GCATTAAATGCAATAGTTTGAGG - Intergenic
1201260096 Y:12150348-12150370 GCATTAAATGCAATAGTTTGAGG + Intergenic
1201464288 Y:14263320-14263342 GGATTAAATGAGAGAGTATTTGG - Intergenic
1201542444 Y:15120988-15121010 AAATTAAATGTGGCAGTTTTTGG + Intergenic