ID: 1175264082

View in Genome Browser
Species Human (GRCh38)
Location 20:57692178-57692200
Sequence TACGATGCCCCCTGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264077_1175264082 23 Left 1175264077 20:57692132-57692154 CCAGGACTGAGCTGAGCCCTTGC No data
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG No data
1175264078_1175264082 7 Left 1175264078 20:57692148-57692170 CCCTTGCCACAAACTGTCTCATT No data
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG No data
1175264080_1175264082 1 Left 1175264080 20:57692154-57692176 CCACAAACTGTCTCATTTAATTC No data
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG No data
1175264076_1175264082 24 Left 1175264076 20:57692131-57692153 CCCAGGACTGAGCTGAGCCCTTG No data
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG No data
1175264079_1175264082 6 Left 1175264079 20:57692149-57692171 CCTTGCCACAAACTGTCTCATTT No data
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264082 Original CRISPR TACGATGCCCCCTGTGTAGT GGG Intronic