ID: 1175264082

View in Genome Browser
Species Human (GRCh38)
Location 20:57692178-57692200
Sequence TACGATGCCCCCTGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264077_1175264082 23 Left 1175264077 20:57692132-57692154 CCAGGACTGAGCTGAGCCCTTGC 0: 1
1: 0
2: 2
3: 29
4: 241
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264080_1175264082 1 Left 1175264080 20:57692154-57692176 CCACAAACTGTCTCATTTAATTC 0: 2
1: 0
2: 6
3: 35
4: 510
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264076_1175264082 24 Left 1175264076 20:57692131-57692153 CCCAGGACTGAGCTGAGCCCTTG 0: 1
1: 1
2: 1
3: 36
4: 290
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264078_1175264082 7 Left 1175264078 20:57692148-57692170 CCCTTGCCACAAACTGTCTCATT 0: 1
1: 0
2: 1
3: 19
4: 227
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31
1175264079_1175264082 6 Left 1175264079 20:57692149-57692171 CCTTGCCACAAACTGTCTCATTT 0: 1
1: 0
2: 5
3: 28
4: 287
Right 1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264082 Original CRISPR TACGATGCCCCCTGTGTAGT GGG Intronic
900217148 1:1487628-1487650 TCTGTTGCCCCCTGTGTAGTTGG + Intronic
920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG + Exonic
923286080 1:232497177-232497199 TCCCATGCCTCCTCTGTAGTTGG - Intronic
924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG + Intergenic
1081426035 11:42927312-42927334 TACCATGGCCCCAGTATAGTGGG - Intergenic
1091294395 11:134463229-134463251 TACAATGCCCATTGTATAGTAGG + Intergenic
1098361286 12:69656796-69656818 TCCCTTGACCCCTGTGTAGTAGG - Intronic
1110157540 13:72336056-72336078 TATGATGCCTCATGTGTACTAGG - Intergenic
1110760948 13:79229498-79229520 TATGAGGCCACTTGTGTAGTAGG - Intergenic
1133971490 16:10571381-10571403 TAAGGTGCCCCCAGTGTGGTTGG - Intronic
1166531718 19:43546860-43546882 TCTGATGCCCCCTGTCCAGTGGG - Intronic
927496516 2:23555079-23555101 CACGAGGTCCCCTGTGTCGTGGG + Intronic
930511542 2:52351333-52351355 TATGATGCCACGTGTGTTGTAGG - Intergenic
932074249 2:68648128-68648150 TAGGGTGCCTCCTGTGGAGTGGG + Intronic
936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG + Intergenic
940106748 2:150109801-150109823 TAAGATGCTCCCTGTCTAGCAGG + Intergenic
947331268 2:229032095-229032117 AACCATGCCCCCTGTGTATTTGG + Intronic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1179242933 21:39608108-39608130 TATCATGCCCACTGTGTAGATGG + Intronic
1181397712 22:22633631-22633653 ACCGATGCCCTCTGTGAAGTTGG - Intergenic
1181792945 22:25282404-25282426 CCCGATGCCCCTTGAGTAGTGGG + Intergenic
954003626 3:47576759-47576781 TACGCTGCCCTCTGTTGAGTCGG + Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG + Intergenic
975226744 4:71881301-71881323 TAGGGTGCTCCCTGTATAGTTGG + Intergenic
976551190 4:86397217-86397239 TAAGAAGCACCCTGTGTGGTTGG + Intronic
988992279 5:36683287-36683309 TACAATGACCCTTGTGAAGTTGG - Intronic
999309115 5:150540192-150540214 GACACTGCCCCCTGTGCAGTTGG + Exonic
1011697732 6:89928003-89928025 TACAATGCCCTGTGTGGAGTTGG - Exonic
1022561043 7:31349812-31349834 TACGATGCTTCCTATGTAGTAGG - Intergenic
1047783900 8:128135002-128135024 CAGGATGGCCCCTTTGTAGTAGG - Intergenic
1051195761 9:14561657-14561679 TACGATGCCCCCTGATAATTTGG - Intergenic
1052231966 9:26164829-26164851 TACCCTGCCCCCTTCGTAGTTGG - Intergenic
1052376863 9:27727497-27727519 TACAATTATCCCTGTGTAGTAGG + Intergenic
1203783370 EBV:113762-113784 GAGGATGCCCCCTTTGTGGTGGG - Intergenic
1191873622 X:65771872-65771894 TACTATGCCCCCTATTTTGTTGG - Intergenic
1192208789 X:69113670-69113692 CACCATGCCCCCTGTGAAGTAGG - Intergenic
1200072398 X:153535650-153535672 TAAGATGCGCCCTGTGCAGCGGG - Intronic