ID: 1175264267

View in Genome Browser
Species Human (GRCh38)
Location 20:57693068-57693090
Sequence TGTTGTGAGCAGGCCGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175264263_1175264267 -5 Left 1175264263 20:57693050-57693072 CCACGATGTTCACGCTTATGTTG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 306
1175264262_1175264267 9 Left 1175264262 20:57693036-57693058 CCGAAGTGGCAAAACCACGATGT 0: 1
1: 0
2: 0
3: 6
4: 140
Right 1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 306
1175264260_1175264267 16 Left 1175264260 20:57693029-57693051 CCAAGTCCCGAAGTGGCAAAACC 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 306
1175264261_1175264267 10 Left 1175264261 20:57693035-57693057 CCCGAAGTGGCAAAACCACGATG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175264267 Original CRISPR TGTTGTGAGCAGGCCGGGAG TGG Intronic
900783733 1:4634374-4634396 TGCTGTGAGTAGGCGGCGAGGGG - Intergenic
901540442 1:9911711-9911733 AAGTGTGAGCAGGCCGGGTGCGG - Intergenic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902468220 1:16630949-16630971 TCTTCTGAGCAGGCCGGGGAGGG + Intergenic
902620709 1:17649260-17649282 TGTTGTGATCAGGCAGGGCAAGG - Intronic
903150114 1:21401538-21401560 GGTTGAGACCAGGCCGGGCGTGG + Intergenic
903176974 1:21587220-21587242 TGGTGTGGGCAGGCAGGGTGCGG + Intergenic
903234945 1:21944096-21944118 TATTGTGTGCAGGCCGGGCGCGG - Intergenic
904345414 1:29865068-29865090 TGTCCTGAGCAGGCAGTGAGAGG + Intergenic
904548342 1:31294647-31294669 TGTTATGTGCAGGCTGGGCGCGG + Intronic
905655738 1:39684865-39684887 AGGTGTGAGCAGGAGGGGAGAGG - Intronic
906215554 1:44036171-44036193 GGTGGGGAGCAGGCCGGAAGAGG + Intergenic
906341904 1:44987793-44987815 TACTGCGAGCAGGCCGGGCGTGG + Intergenic
906606194 1:47174037-47174059 TATTGCAAGCAGGCCGGGCGCGG + Intergenic
906808282 1:48801281-48801303 CGGTGTGGGCAGGCAGGGAGGGG - Intronic
907914138 1:58853293-58853315 CGTTCTGTGCAGGGCGGGAGAGG - Intergenic
910812717 1:91254175-91254197 TGTGGTGGGCAGCCTGGGAGAGG + Intergenic
911543451 1:99186544-99186566 TGTTGTTAGGAGGCAGGGACAGG + Intergenic
911749543 1:101480790-101480812 AGGTGTGAGCAGGGCAGGAGAGG + Intergenic
912538073 1:110390784-110390806 TCTGGTGAGCAGGCTGGGTGGGG + Intronic
914293388 1:146296338-146296360 TGTTGAGAGTAGACCGGGGGTGG + Intergenic
914554432 1:148747121-148747143 TGTTGAGAGTAGACCGGGGGTGG + Intergenic
915801243 1:158795357-158795379 TGTTATGAGCAAACCAGGAGGGG - Intergenic
917291501 1:173476826-173476848 TGTAGGGAGCTGGCCGCGAGTGG + Intergenic
917869577 1:179229538-179229560 TGCCGTGAGGAGGCCGGGTGCGG - Exonic
919194048 1:194260557-194260579 TGTTGTGGGGGGGGCGGGAGGGG + Intergenic
919977729 1:202623540-202623562 GCTTGGGAGCAGGCCGGGAAGGG + Intronic
920062900 1:203240063-203240085 TTTAGTCAGCAGGCAGGGAGTGG - Intronic
920179824 1:204125774-204125796 TGCTCTGAGGAGGCCTGGAGGGG + Intronic
920296634 1:204961451-204961473 CCTTGTGAGGATGCCGGGAGAGG - Intronic
922466288 1:225847274-225847296 TGTTGGGAGAAGGGCAGGAGGGG - Intronic
922640691 1:227228120-227228142 AGGTGGGGGCAGGCCGGGAGAGG + Intronic
922706285 1:227792479-227792501 ATTTGTGAGCAGTCCAGGAGAGG + Intergenic
923005434 1:230045673-230045695 TCTTGGGAGGAGGCCGGGCGCGG + Intergenic
1063135897 10:3215812-3215834 TGTTGTGCAGAGGCCGTGAGAGG + Intergenic
1063778519 10:9292857-9292879 TATTTTGAGCAGGCCAGGCGAGG - Intergenic
1064056919 10:12105803-12105825 TGTGGTGATGAGGCCGGGCGTGG + Intronic
1064659251 10:17589578-17589600 TGTTGTATTCAGGCTGGGAGTGG - Exonic
1065063894 10:21939177-21939199 TACTTTGAGCGGGCCGGGAGCGG - Intronic
1065209742 10:23391066-23391088 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1066269463 10:33808286-33808308 TGTTATGAAAAGGCTGGGAGAGG - Intergenic
1066326787 10:34368380-34368402 AGGTGAGAGCAGGCCGGGCGCGG + Intronic
1066438826 10:35418323-35418345 TGTGGTGATCAAGCCGGGGGTGG - Intronic
1070722444 10:78765919-78765941 TGGTGTGGTCAGGCCGTGAGTGG - Intergenic
1072206869 10:93212448-93212470 GGCTGTGAGCAGGGCGGGAAGGG + Intergenic
1072426900 10:95337518-95337540 TGATGTGTGCAGGCAGGGGGTGG + Intronic
1072620587 10:97076517-97076539 TGGAGAGAGCAGGCAGGGAGGGG - Intronic
1075081269 10:119385466-119385488 TGTTGGGAGCAGGCTTTGAGGGG + Intronic
1076072770 10:127504817-127504839 TGATGGGAGCAGGTAGGGAGAGG - Intergenic
1076235861 10:128863440-128863462 AGTTGAGTGCAGGCCGGGTGCGG - Intergenic
1076547745 10:131257168-131257190 TGTTGGGTGCAGGCAGGGCGGGG + Intronic
1078381259 11:10843239-10843261 TGTTGTGAGCTGCCCTGTAGAGG + Intronic
1078443021 11:11383165-11383187 TGCCCTGAGCAGGCCCGGAGAGG - Intronic
1079134421 11:17768373-17768395 TGTTGGGTGCATGCAGGGAGAGG + Intronic
1079302022 11:19286508-19286530 TGCTGTGGGCAGTCTGGGAGAGG - Intergenic
1079315993 11:19408280-19408302 TGTTGCAAGCAGGCAGGGAAAGG + Intronic
1080231371 11:30020240-30020262 TGGTGGGAGAAGGCTGGGAGGGG - Intergenic
1080967905 11:37234897-37234919 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1084006534 11:66326326-66326348 GGCTGTGACCAGGCCGGGAAGGG + Intergenic
1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG + Intronic
1085359391 11:75872675-75872697 TCATGCCAGCAGGCCGGGAGTGG - Intronic
1085413907 11:76307640-76307662 TGTGGGGAGCAGGGCGGGCGGGG + Intergenic
1086998010 11:93380691-93380713 TGTTATTAGCTGGCCGGGCGCGG - Intronic
1088544569 11:110946608-110946630 TAATGTGAGCAGGAGGGGAGTGG - Intergenic
1089945750 11:122471556-122471578 GGTTGTGAGCATGCTGGCAGTGG + Intergenic
1089977074 11:122742030-122742052 TTTTGTGAGGAGGTAGGGAGGGG - Intronic
1090477894 11:127040124-127040146 TGATGTGAACATGCAGGGAGTGG - Intergenic
1091247337 11:134109250-134109272 TGGTGAGAGCAGGCCGGGCACGG - Intronic
1092369435 12:7904337-7904359 TGTTAATAGCAGGCCGGGTGCGG - Intergenic
1094026409 12:25964011-25964033 TGTTGAGAGCAAGCCCTGAGAGG + Intronic
1095101239 12:38186155-38186177 TGTTGTGGGCTGGGGGGGAGGGG + Intergenic
1098305109 12:69095158-69095180 TGTGGTGATCAGGCCAGGGGGGG + Intergenic
1098519653 12:71421048-71421070 TGTTGTGAGCAGCCTGGGCATGG - Intronic
1100857412 12:98770055-98770077 TGACGTCAGCAGGCAGGGAGAGG + Intronic
1101151956 12:101891037-101891059 TGTGGGGGGCAGGCCGGGCGCGG - Intronic
1102259557 12:111435941-111435963 TGCTGGGACCAGGCCTGGAGTGG + Intronic
1102494626 12:113311022-113311044 TTATGTGAGGAGGCCGGGTGTGG + Intronic
1102688891 12:114745001-114745023 TCTTGTGAGCACCCGGGGAGGGG + Intergenic
1104067368 12:125316963-125316985 TGTGGTGGGCAGGCAAGGAGAGG - Intronic
1105495170 13:20924165-20924187 TGTAGAGACCAGGCCGGGAGCGG + Intergenic
1105600499 13:21882231-21882253 TCATGTGAGCAGGCTGGGTGCGG - Intergenic
1105621140 13:22067696-22067718 AGTTGTGAACAGGCTGGGTGAGG + Intergenic
1107549714 13:41463500-41463522 TGTGGTGGGCAGGGCGGGGGCGG + Intronic
1107732287 13:43360219-43360241 GGTTGGGAGCAGGAGGGGAGAGG - Intronic
1108747031 13:53406340-53406362 TGATTTGAGCAGGGCAGGAGTGG + Intergenic
1109299183 13:60573154-60573176 TGTGGGGAGCAGGCAGGGGGAGG + Intronic
1113134396 13:107073666-107073688 TGTCCTGAGCAGTCGGGGAGGGG + Intergenic
1115537086 14:34383481-34383503 TGATGTGAGCAGCCCAGGGGAGG - Intronic
1115678867 14:35713803-35713825 TGATGTGAGCGGGCCAGGTGCGG + Intronic
1115970653 14:38941313-38941335 AAATGTGTGCAGGCCGGGAGCGG - Intergenic
1116269343 14:42741588-42741610 TGTTGGGGGCAGGCAAGGAGTGG - Intergenic
1117048504 14:51837147-51837169 AGTTGAGATCAGGCCGGGTGCGG - Intronic
1117793240 14:59363096-59363118 TTTTGTGAACAGGCCTGTAGGGG - Intronic
1119256786 14:73205184-73205206 TACTGTGACCAGGCCGGGCGTGG + Intronic
1122117187 14:99533687-99533709 TGGTGGGAGCAGGCCTGGGGAGG + Intronic
1122873728 14:104653340-104653362 TGGTGTAACCAGGCCGGGCGAGG + Intergenic
1122921043 14:104880266-104880288 TGCTGTGGGCAGGCCAGGCGGGG - Exonic
1124319396 15:28702173-28702195 TGGTGTGGGCAGGCAGGAAGAGG - Intronic
1124455671 15:29840592-29840614 TGTTGTGGGCAGGATGGGCGGGG - Intronic
1127262230 15:57334847-57334869 TGCTGTGAGCTGCCCTGGAGTGG - Intergenic
1129262611 15:74377163-74377185 TGCTGTGGCCAGGCTGGGAGGGG + Intergenic
1130970668 15:88729515-88729537 TATTGTGAGCAGTCTGGAAGTGG + Intergenic
1132580898 16:684215-684237 GGTGGTGAGCGGCCCGGGAGGGG - Exonic
1133096084 16:3446899-3446921 TGCAGTGAGCAGGCCAGGTGCGG - Intronic
1133489084 16:6249607-6249629 AGTAGTGATCAGGCAGGGAGTGG + Intronic
1133877000 16:9744428-9744450 TGTTCTGAGCATGCCAGGGGTGG + Intergenic
1134184841 16:12076590-12076612 TGTTATGACCAGGCTGGGCGTGG - Intronic
1134184997 16:12077909-12077931 TGCTGTGACCAGGCCAGGTGTGG - Intronic
1136174823 16:28509340-28509362 TGTTGGGATTAGGCCGGGCGCGG - Intronic
1137759348 16:50927867-50927889 TGTTTTTAGCCGGCCGGGCGCGG - Intergenic
1138633654 16:58319482-58319504 TCTTGCCAGCAGGCAGGGAGGGG - Intronic
1138853868 16:60663596-60663618 TTTTGTGGGCATGCTGGGAGAGG - Intergenic
1138964853 16:62071768-62071790 TGTGATGAGCAGGCTGGGCGTGG - Intergenic
1140127970 16:72133635-72133657 AGGTGTGAGCAGGGCAGGAGAGG + Intronic
1140427881 16:74875798-74875820 TCTTGTGGGCAGGCATGGAGTGG - Intronic
1142227145 16:88883066-88883088 TGTGGTCACCAGGCAGGGAGCGG + Intronic
1142285669 16:89170594-89170616 TCTTTTGAGCAGGCAGGGTGGGG - Intergenic
1142298549 16:89242951-89242973 TCTTTTGAGCAGGCAGGGTGGGG - Intergenic
1142619198 17:1154290-1154312 TGTGGGGTGCAGGCGGGGAGGGG - Intronic
1142702321 17:1670775-1670797 TGATGAGAGCAGGCCAGGCGCGG - Intronic
1143278309 17:5731077-5731099 TGTTGGGAGCATGACTGGAGAGG - Intergenic
1143682377 17:8486993-8487015 TGGTGTGAGCAGGCAGGCAGGGG - Intronic
1145053383 17:19681510-19681532 TGGTGTGAGGAAGTCGGGAGAGG - Intronic
1145825608 17:27875088-27875110 TCTGGTGAGCAGGCCTGGCGCGG - Intronic
1146930211 17:36771682-36771704 AGATGGCAGCAGGCCGGGAGAGG + Intergenic
1147601181 17:41746556-41746578 TGATGTGACCAGCCTGGGAGAGG - Intergenic
1148332006 17:46818850-46818872 AGTTGTGGGCCGGGCGGGAGGGG - Intronic
1148693500 17:49545990-49546012 TGTTGTGACCAGGCAGGCCGCGG - Intergenic
1149566370 17:57643411-57643433 CGCTGTGGGCAGGCAGGGAGAGG + Intronic
1150719253 17:67600222-67600244 TGGTGTGAGGAGTCAGGGAGTGG + Intronic
1151705036 17:75762971-75762993 TGCTGAGTGCAGGGCGGGAGGGG + Intronic
1152215148 17:79027668-79027690 CGGTGTGAGCAGGAAGGGAGGGG + Intronic
1152329596 17:79664636-79664658 TGGTGAGAGTAGGCCGGGCGCGG - Intergenic
1152756893 17:82090736-82090758 TGCTGGGGGCAGGACGGGAGGGG - Intronic
1152923155 17:83075956-83075978 TGTGGGGAGCACGGCGGGAGGGG + Intergenic
1155668680 18:28343024-28343046 TGTTGTGGGGTGGCGGGGAGAGG + Intergenic
1156384413 18:36592766-36592788 TGGAGGGAGCAGGCTGGGAGTGG + Intronic
1156459995 18:37316229-37316251 TGTTCAGGGCAGGCAGGGAGGGG + Intronic
1157301291 18:46481677-46481699 TGTTGTCACCAGGGCTGGAGCGG - Intronic
1159582666 18:70250506-70250528 ACTTGAGAGCAGGCCGGGCGCGG + Intergenic
1161057758 19:2199262-2199284 TGCTGTTAGCAGGCCGTCAGCGG + Intronic
1161459066 19:4385715-4385737 TGCTGTGGGAAGGCTGGGAGTGG + Intronic
1162614450 19:11786175-11786197 TGTGTTGACAAGGCCGGGAGCGG + Intergenic
1163387327 19:17007875-17007897 AGCTGGGAGCAGGCCGGGCGTGG + Intronic
1163549511 19:17957824-17957846 TGTGGAGAGCAGGGCAGGAGTGG + Intronic
1163557352 19:18000305-18000327 AGTTATGAACAGGCCGGGCGTGG + Intergenic
1163648243 19:18502354-18502376 AGTTGTGGGCAGGCCAGGAGGGG + Intronic
1164870939 19:31642150-31642172 TGTTGTGAGGAGGCCCATAGGGG + Intergenic
1165086585 19:33352683-33352705 TGATGTGAACAGGCCGGGTGTGG - Intergenic
1166839543 19:45688342-45688364 TGTTCTCCGCAGGCCTGGAGAGG - Intronic
1167111796 19:47466775-47466797 TGTTCATAGCAGGCCGGGTGCGG + Intronic
1168495069 19:56840811-56840833 TGTGGTGAGGGGGCCCGGAGAGG - Intergenic
927730028 2:25462991-25463013 TGTTCTGAGTAGGCCGGGCGCGG - Intronic
928452542 2:31389292-31389314 AGTTGTAAGCAGGCAGGCAGTGG + Intronic
930027692 2:47039410-47039432 TGGGGTGAGCAGCCAGGGAGGGG + Intronic
930863512 2:56099274-56099296 TGTAGTGAGCAGCTAGGGAGTGG - Intergenic
932152610 2:69387046-69387068 TGTGGTAAGGGGGCCGGGAGCGG - Exonic
932594212 2:73084082-73084104 TCTGGGGAGCTGGCCGGGAGAGG - Intronic
932913396 2:75829277-75829299 AGGTGTCAGCAGGCCGGGCGCGG + Intergenic
934534461 2:95121685-95121707 GGCTCTGAGCGGGCCGGGAGTGG - Intronic
935043602 2:99458916-99458938 TGTAGTGTGGAGGCCGGGCGCGG + Intronic
935217280 2:100984105-100984127 TGTTCTGAGCCGGCCGGCATGGG + Intronic
936018103 2:108974860-108974882 TGTTGTGGGCAGGCCTGGTGAGG - Intronic
937001015 2:118467660-118467682 TGTCATGAGCAGGCAGGGAAGGG + Intergenic
937960733 2:127456022-127456044 TGCTGTGAGCAGGCACTGAGTGG + Intronic
938252659 2:129827670-129827692 GGTTGGGCTCAGGCCGGGAGAGG + Intergenic
939246002 2:139624439-139624461 TTTTGTGAGCAGGTAGGGTGAGG + Intergenic
939454549 2:142417392-142417414 TGTTTTGAGCATGCTTGGAGAGG + Intergenic
941867871 2:170353396-170353418 AGTTGTGGGCAGGGAGGGAGGGG + Intronic
942486690 2:176447051-176447073 TGGAGTGAGCAGGCCAGGACAGG - Intergenic
946245534 2:218385126-218385148 AGCTGTGAGGAGGCAGGGAGAGG - Exonic
946919235 2:224560709-224560731 TGATGATAGCAGGCCAGGAGTGG - Intronic
947494928 2:230628117-230628139 TGGTGGGAGCAAGCAGGGAGAGG - Intergenic
947581713 2:231323937-231323959 TGTTGTGAGCAGGTCAGCTGCGG + Intronic
948397268 2:237654838-237654860 TATTTTCAACAGGCCGGGAGTGG - Intronic
1169745354 20:8937134-8937156 TGTAGGCAGCAGGCCGGAAGTGG + Intronic
1172067733 20:32233588-32233610 TGTGGTGAGCAGACCAGGAGAGG + Intronic
1172520960 20:35565153-35565175 TGGTGAGCGCTGGCCGGGAGCGG - Intergenic
1173845211 20:46183929-46183951 TGTGGTGAGCAGGACTGGGGTGG - Intronic
1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG + Intronic
1175631153 20:60537405-60537427 TGGTCTGAGCAGGGCAGGAGAGG - Intergenic
1176164901 20:63667746-63667768 TTTTCTGAGCAGTCTGGGAGCGG + Intronic
1176209307 20:63910252-63910274 TGATGTGCGCTGGCCGGGCGCGG + Intronic
1176218516 20:63959265-63959287 GGTAGTGGGCAGGCCTGGAGAGG + Exonic
1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG + Intronic
1177631256 21:23731203-23731225 AGTTATAAGCAGGCCGGGTGTGG - Intergenic
1179826740 21:43970294-43970316 TGTTAACAGCAGGCCGGGCGTGG - Intronic
1180140971 21:45893210-45893232 TGTCTTGAGCAGGGAGGGAGTGG + Intronic
1180165542 21:46023989-46024011 TCTTGTGGGCAGGCTGTGAGGGG + Intergenic
1180675837 22:17585941-17585963 TGTTGTGAGGTGGCCGGGCACGG - Intronic
1181534573 22:23534815-23534837 TGGAGTGGCCAGGCCGGGAGTGG + Intergenic
1181630363 22:24147969-24147991 GGGTGTGAGCAGGCAGGAAGAGG + Intronic
1181730177 22:24840232-24840254 TGTTTTGCCCAGGCCGGGCGTGG - Intronic
1181749119 22:24976678-24976700 TGTGGGGAGCAGGCAGGGAAAGG - Intronic
1182357156 22:29727374-29727396 CGTTGTGAGCACACCAGGAGAGG + Intronic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
1182438930 22:30350164-30350186 TGTTGGGAACAGGCCAGGTGCGG + Intronic
1182619971 22:31613551-31613573 TGTGGGGAGCAGGCAGGGTGTGG + Intronic
1183096812 22:35557081-35557103 GGCTCTGAGCAGGCCGGGTGAGG + Intergenic
1183751663 22:39724381-39724403 TGATGGGAGCAGGCTGGGTGAGG - Intergenic
1184805793 22:46794137-46794159 TGTTGTGGGCTGGCCGTGAGAGG + Intronic
1185193177 22:49451740-49451762 TGTTTTGGGCAGGGCTGGAGGGG - Intronic
1203296224 22_KI270736v1_random:45301-45323 TGTGGTGGGGAGGCCGGGGGAGG - Intergenic
949897142 3:8776316-8776338 TGTTGTGGGCACCCGGGGAGAGG + Intronic
951260700 3:20504309-20504331 TGAAGTGGGCAGGCAGGGAGGGG - Intergenic
952782801 3:37119950-37119972 TATTTTGAAAAGGCCGGGAGCGG - Intronic
953633335 3:44639441-44639463 TTTTGTGTGCAGGCAGGGGGTGG + Intronic
953869663 3:46615453-46615475 TGCTGTGACCAGGACGGGAGGGG - Intronic
953894894 3:46789526-46789548 TGTTGTGAGGATTCGGGGAGTGG + Intronic
954390045 3:50263905-50263927 TGTACTGAGGTGGCCGGGAGCGG + Intergenic
955187198 3:56725902-56725924 TGGTGAGAGCTGGCCGGGCGTGG + Intergenic
957865040 3:86012508-86012530 TGCCCTGAGGAGGCCGGGAGCGG + Intronic
959775783 3:110161379-110161401 TGTTGTGAGCTGCCCTGTAGAGG - Intergenic
960605986 3:119505655-119505677 TGTTATGTTCAGGCCGGGCGTGG - Intronic
961165610 3:124761546-124761568 TGTTGTGCCCAGGCCAGGCGCGG + Intergenic
964331516 3:155608366-155608388 CAGTGTGAGCAGGCAGGGAGGGG + Intronic
964892617 3:161555119-161555141 TGTGGTGGGCAGGACTGGAGTGG - Intergenic
966666525 3:182477897-182477919 CATTGTGAGCAGGCCTGGGGAGG + Intergenic
967470653 3:189858113-189858135 TGTTGTGTATAGGCCGGGCGCGG + Intronic
968091846 3:195903038-195903060 TGGTGTTAGCTGGCCGGGTGCGG - Intronic
968091894 3:195903328-195903350 TGGTGTTAGCTGGCCGGGCGCGG - Intronic
970592515 4:17571828-17571850 TTATGACAGCAGGCCGGGAGCGG + Intergenic
971469759 4:27010159-27010181 TGTTGTGATCAGGCCAGGCACGG + Intronic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
972479576 4:39485144-39485166 TTTGGTGAGCCAGCCGGGAGAGG + Intergenic
973635861 4:52861914-52861936 TGCTCTGGGCGGGCCGGGAGCGG - Intergenic
974531126 4:63109042-63109064 AGTTGTGAGGAGGGAGGGAGTGG + Intergenic
977051826 4:92137723-92137745 TGTTATAAGAAGGCCGGGTGCGG - Intergenic
977929672 4:102737271-102737293 AGGTGTGAGCAGGTGGGGAGGGG + Intronic
978603332 4:110451035-110451057 AGTGGTGAGCAGGCCAGGCGTGG - Intronic
979109957 4:116740501-116740523 TGCTGGGAGCAAGCAGGGAGTGG + Intergenic
981064150 4:140463409-140463431 AGGTGTGGGCAGGCAGGGAGGGG + Intronic
982136071 4:152275568-152275590 TGTTGGGAGCAAGTGGGGAGGGG - Intergenic
985776682 5:1847991-1848013 TGTTGGGAGGAGGCTGGGTGTGG + Intergenic
985779735 5:1864109-1864131 TGGTGTGAGCAGGGCAGAAGAGG - Intergenic
985963571 5:3322213-3322235 AGCTGTGAGCAGGCCAGGAGTGG + Intergenic
987068731 5:14315539-14315561 TCTAGTAAGCAGGCCGGGTGTGG - Intronic
987160402 5:15135502-15135524 TAGTTTGAGCAGGCCGGGTGCGG - Intergenic
987878471 5:23711215-23711237 AGGGGTGAGCAGGACGGGAGAGG - Intergenic
988593023 5:32565440-32565462 TGTTGTGAGCATCCATGGAGAGG + Intronic
993901351 5:93585679-93585701 AGATGAGCGCAGGCCGGGAGGGG - Intronic
997452793 5:133996901-133996923 AGGTGGGAGCAGGCAGGGAGTGG - Intronic
998002051 5:138633116-138633138 GGATGTGAGCAGGCCGGGCGTGG - Intronic
998106075 5:139470204-139470226 TGTGGTGAGAAGGAGGGGAGAGG + Intergenic
998952794 5:147408727-147408749 TGTACTGAGCAGGCCAGAAGAGG - Exonic
999105495 5:149067358-149067380 TTTGGTGGGCAGGCAGGGAGGGG + Intergenic
1000616948 5:163437747-163437769 TGAGGTGAGCAGGCCCGGGGAGG + Exonic
1001395691 5:171418760-171418782 TTTTGGGAGGAGGCCGGAAGAGG + Intergenic
1001485853 5:172119178-172119200 AGGTCTGAGCAGGCAGGGAGCGG + Intronic
1002394408 5:178941762-178941784 TTGTGTGAGCTGGGCGGGAGGGG - Intronic
1002529725 5:179837022-179837044 TGTTGTCAGCAGGCAGGCTGGGG + Exonic
1002570282 5:180136166-180136188 TGGTGAGAGCAGTCAGGGAGAGG + Intronic
1005410844 6:25544372-25544394 GGTTGGGGGCAGGCAGGGAGAGG + Intronic
1005678204 6:28178422-28178444 ACTTGTAAGCAGGCCGGGCGTGG + Intergenic
1005911222 6:30311300-30311322 TGTTGTGGGGAGGCCGGGGTGGG - Intergenic
1006603862 6:35242957-35242979 TGCTGTGAGCAGGAGGGCAGGGG - Intronic
1007378512 6:41471888-41471910 TGGGGTGAGGAGGCAGGGAGTGG + Intergenic
1007629255 6:43263629-43263651 TGTTTTGCACAGGCCGGGAGGGG + Intronic
1008352117 6:50504318-50504340 TGATGTGGGTAGGCCGGGTGCGG + Intergenic
1011577431 6:88818047-88818069 TGATGTGAATAGGCCGGGCGCGG - Intronic
1011699765 6:89944697-89944719 TGTTGGGGGCAGGCAGGGGGCGG - Intronic
1011838081 6:91458575-91458597 AGTTGTGATCATGCTGGGAGAGG + Intergenic
1013111905 6:107070877-107070899 AATGGTGAGCAGGCCGGCAGGGG - Exonic
1013502203 6:110763703-110763725 TGGTGAGAGCAGGCTGGGCGTGG - Intronic
1017778475 6:157698052-157698074 TATTCTGAGCCGGCCGGGCGCGG + Intergenic
1018219172 6:161561584-161561606 TGTTGTGAGAGGGGCTGGAGAGG - Intronic
1020404469 7:7816449-7816471 TGTAGAGATGAGGCCGGGAGAGG + Intronic
1023735658 7:43234181-43234203 TGGTGTGAACAGGGTGGGAGAGG - Intronic
1024694676 7:51843232-51843254 GGTTGTTAGGAGGCTGGGAGTGG - Intergenic
1026888588 7:73969157-73969179 ACTTGTGAGCAGGCAGGCAGGGG + Intergenic
1028581231 7:92411562-92411584 TGGTATGAGCAGGGTGGGAGAGG - Intergenic
1033241514 7:139683454-139683476 TGTTGTGAGCAGTCCTGTGGAGG - Intronic
1033474409 7:141677133-141677155 TGGTCTGAACAGGCCGGGCGTGG + Intronic
1034502550 7:151460226-151460248 TGATGGGAGCAGGAGGGGAGTGG + Intergenic
1034662609 7:152785371-152785393 TGTTGTGAGGGGGGGGGGAGGGG + Intronic
1035581926 8:745975-745997 TGGCCTGAGCAGGCCGTGAGGGG - Intergenic
1037880774 8:22572447-22572469 GTATGTGGGCAGGCCGGGAGGGG + Intronic
1037967352 8:23145105-23145127 TCTCCTGAGCAGGCGGGGAGGGG + Intronic
1039829815 8:41204065-41204087 GCTTGTTAGCTGGCCGGGAGGGG + Intergenic
1040468765 8:47719015-47719037 GGTGGTGAGCAGGAAGGGAGTGG + Intronic
1041317706 8:56581751-56581773 TTTTGTCAACAGGCCAGGAGAGG + Intergenic
1042480370 8:69295887-69295909 TGGGGTGGGCAGGACGGGAGTGG - Intergenic
1049006253 8:139857500-139857522 TGGTGTCAGCAGGCCTGGACTGG - Intronic
1049758420 8:144320978-144321000 TGTTGTGAGCTGGGCCTGAGGGG - Intronic
1049758879 8:144322927-144322949 GGTTGTGGGCAGGCAGTGAGTGG - Intronic
1050626542 9:7510219-7510241 TGTTGTGAGCCGCCCGGGCTAGG + Intergenic
1050904015 9:10981213-10981235 TGTTGTGGGGTGGCAGGGAGGGG - Intergenic
1053437401 9:38085459-38085481 TGTTGTTAAAAGGCCCGGAGTGG + Intergenic
1054768997 9:69067226-69067248 TGTGGGCAGCAGGCCGGGAGTGG - Intronic
1057263417 9:93598728-93598750 TGTTGTCAGCAGCCTGGGATGGG - Intronic
1057320637 9:94009583-94009605 TGTTTAGAACAGGCCGGGCGCGG + Intergenic
1058648882 9:107156428-107156450 AGCTGTGAGCAGGCCGAGATGGG - Intergenic
1059486163 9:114628551-114628573 TGTTGTGAGCACCCAGGGAGAGG - Intronic
1060149873 9:121281767-121281789 TGTAGGGAGGAGGCCGGGACTGG + Intronic
1061049583 9:128186478-128186500 TTTTGGGAGGAGGCAGGGAGTGG - Intronic
1061245850 9:129401020-129401042 TGGGGTGGCCAGGCCGGGAGTGG - Intergenic
1061422707 9:130480759-130480781 TGGGGTGGGCAGGCCGGGTGTGG + Intronic
1061705342 9:132448899-132448921 TATTATGAGCAGTCGGGGAGTGG + Intronic
1061887415 9:133598889-133598911 TGTTCTGAGCAGCCTGAGAGGGG - Intergenic
1062020620 9:134317839-134317861 TGCTGTGAGCTGGCTGGGTGGGG - Intronic
1062020682 9:134318058-134318080 TGCTGTGAGCTGGCTGGGTGGGG - Intronic
1062020692 9:134318093-134318115 TGCTGTGAGCTGGCTGGGTGGGG - Intronic
1062020700 9:134318126-134318148 TGCTGTGAGCTGGCTGGGGGGGG - Intronic
1062032491 9:134367980-134368002 TACTCTGAGCAGGCAGGGAGCGG - Intronic
1062117859 9:134818760-134818782 TGTGGTGAGTAGGCTGTGAGGGG + Exonic
1062125111 9:134856014-134856036 TGATGAGAGTAGGCAGGGAGCGG + Intergenic
1062357573 9:136172035-136172057 TGTTCTGAGGAGGCTGGCAGTGG + Intergenic
1062628279 9:137452706-137452728 TGTTGGGGGCAGGCCCGGGGCGG + Intronic
1185678813 X:1871361-1871383 AGATGTGGGCAGGCCGGGCGCGG - Intergenic
1185679034 X:1873148-1873170 AGATGTGGGCAGGCCGGGCGCGG - Intergenic
1187509981 X:19908960-19908982 TGGTATGAGCAGGGCAGGAGAGG - Intergenic
1189522710 X:41786523-41786545 AATTGTAATCAGGCCGGGAGTGG - Intronic
1190291345 X:48994512-48994534 TATTGCAAGCAGGCCGGGTGCGG - Intronic
1190573235 X:51806260-51806282 TGCTTTGAGCTGGCCGGGCGCGG - Intronic
1191616623 X:63176610-63176632 CTTTGTGAGCAGACAGGGAGGGG + Intergenic
1191619674 X:63202313-63202335 CTTTGTGAGCAGACAGGGAGGGG - Intergenic
1194417972 X:93636982-93637004 TGTTGTGACCAGGCCAGGCATGG + Intergenic
1195758700 X:108224020-108224042 TGGTGTGAGCAGGATGGGACTGG - Intronic
1197207928 X:123805729-123805751 TGTTGTAAATAAGCCGGGAGCGG + Intergenic
1198284086 X:135172532-135172554 GGTTGTGAACAGGCTGGAAGAGG + Intergenic
1201941553 Y:19466018-19466040 TGTGGAGAGCAGGCAGGAAGTGG - Intergenic