ID: 1175266077

View in Genome Browser
Species Human (GRCh38)
Location 20:57704278-57704300
Sequence AACTCAGTTGTCTTTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175266077_1175266090 20 Left 1175266077 20:57704278-57704300 CCCACCCCAAAGACAACTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1175266090 20:57704321-57704343 CCCCAGCCTCGGGGAGCCCCTGG 0: 1
1: 0
2: 5
3: 83
4: 625
1175266077_1175266084 9 Left 1175266077 20:57704278-57704300 CCCACCCCAAAGACAACTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1175266084 20:57704310-57704332 GAACCATGCTCCCCCAGCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 297
1175266077_1175266094 30 Left 1175266077 20:57704278-57704300 CCCACCCCAAAGACAACTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1175266094 20:57704331-57704353 GGGGAGCCCCTGGCACAGCATGG 0: 1
1: 0
2: 5
3: 57
4: 406
1175266077_1175266085 10 Left 1175266077 20:57704278-57704300 CCCACCCCAAAGACAACTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1175266085 20:57704311-57704333 AACCATGCTCCCCCAGCCTCGGG 0: 1
1: 1
2: 2
3: 31
4: 274
1175266077_1175266086 11 Left 1175266077 20:57704278-57704300 CCCACCCCAAAGACAACTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1175266086 20:57704312-57704334 ACCATGCTCCCCCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 23
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175266077 Original CRISPR AACTCAGTTGTCTTTGGGGT GGG (reversed) Intronic
901283969 1:8061649-8061671 AAATCAGTAGAATTTGGGGTGGG - Intergenic
902408038 1:16196995-16197017 TACTCTGTTGTCCTTGGTGTTGG - Intergenic
902906723 1:19563790-19563812 AACTCAGCTCTGTTTTGGGTGGG + Intergenic
903983053 1:27203755-27203777 AACTCATTTGCCTTTGGTGTTGG - Intergenic
904954062 1:34268353-34268375 GACTCAGTTTCCTTGGGGGTTGG + Intergenic
905979894 1:42215157-42215179 AACTCAGTCTTTTTTGGAGTGGG - Intronic
907369254 1:53989420-53989442 AACTGAGATGTCTGTGGTGTTGG - Intergenic
909198861 1:72663127-72663149 AACTGAGATGTCTATGGTGTTGG - Intergenic
915610409 1:156987537-156987559 AACACAGTTGTCTCTGAGGAGGG + Intronic
920572117 1:207025061-207025083 CACTCTGTTGGGTTTGGGGTTGG + Exonic
923757790 1:236808970-236808992 AACTCTGTGGTCCTTGGGCTCGG + Intronic
923858448 1:237869152-237869174 AGCTCAGTTTACTTTGGGGCAGG - Intergenic
1064572046 10:16703541-16703563 AACTCAGATGTCTAGGGGGTTGG + Intronic
1068919592 10:62468782-62468804 AACTGAGATGTCTATGGTGTTGG - Intronic
1069955400 10:72047739-72047761 GCCTCAGCTGTCTTAGGGGTGGG - Intergenic
1070446045 10:76503857-76503879 TTCTCTGTTATCTTTGGGGTTGG + Intronic
1070939834 10:80334767-80334789 AACACAGTTGTATTTGGGAAGGG + Intergenic
1071994891 10:91137715-91137737 TTCTCAGGTGTCTTTGGGCTTGG + Intergenic
1072722830 10:97791484-97791506 AACTGGGTTGTATCTGGGGTGGG - Intergenic
1072752827 10:97995639-97995661 AGCTCACTTTTCTGTGGGGTGGG - Intronic
1072895470 10:99362614-99362636 AACTCAGCGATGTTTGGGGTGGG + Intronic
1073329552 10:102661405-102661427 CTCCCAGCTGTCTTTGGGGTGGG + Intergenic
1074213665 10:111362718-111362740 TACTCATTTGTGTGTGGGGTGGG - Intergenic
1074809920 10:117093622-117093644 AAGTCCGTAGCCTTTGGGGTTGG - Intronic
1076232050 10:128828601-128828623 AACTGAGATGTCTATGGTGTTGG - Intergenic
1076304845 10:129458639-129458661 AACTCTGCAGTCTTTGGAGTTGG + Intergenic
1077203446 11:1326383-1326405 AACTCAGGTGACATTGGGGAAGG - Intergenic
1079350038 11:19684681-19684703 CACTCTGGTGTCTGTGGGGTTGG - Intronic
1079697366 11:23498537-23498559 AAATCAGATGTCTTAGGAGTTGG - Intergenic
1080577317 11:33611668-33611690 ACTTCAGTGGTCTTTGGGATAGG + Intronic
1085797085 11:79551874-79551896 GACTCTGTTGTCTTTGGGTGTGG + Intergenic
1086019766 11:82213499-82213521 AATTGAGATGTCTTTGGTGTTGG - Intergenic
1086322765 11:85667460-85667482 AACTCATTTTTCTTTGAAGTAGG + Intronic
1088220543 11:107565863-107565885 AATTCAGTTGTCTTTTTGGGGGG + Intergenic
1090886190 11:130878975-130878997 AACACAGTCTACTTTGGGGTAGG + Intronic
1091087111 11:132732270-132732292 GACTTAGTTGTCATTGGGGAAGG - Intronic
1092281451 12:7100960-7100982 AACACAGTTGTTTCTGGGGAGGG + Intronic
1092282813 12:7110186-7110208 TCCCCAGTTGTGTTTGGGGTTGG - Intergenic
1092455285 12:8637425-8637447 ATCGCAGCTGTCTTTGGGCTTGG + Intronic
1093128054 12:15354041-15354063 AACTAAGATGTCTATGGTGTTGG + Intronic
1096522118 12:52190228-52190250 AAGTCAGTGGTCTCTGTGGTGGG - Intronic
1103894518 12:124264258-124264280 AACTCAGTTGGCCTTGGGAGGGG + Intronic
1105018771 12:132802614-132802636 AATTCATTTGTCTTTGAGATGGG - Intronic
1105048155 12:133024234-133024256 AACCCAGTGGGCTTTGGGGATGG + Exonic
1106757195 13:32834685-32834707 AACTGAGATGTCTGTGGTGTTGG - Intergenic
1106838792 13:33664432-33664454 AACTGTGTTGTCTTTGGACTTGG + Intergenic
1107566222 13:41607623-41607645 GACACAGCTGTCTGTGGGGTGGG + Intronic
1108523626 13:51266410-51266432 AACTGAACTGGCTTTGGGGTTGG - Intronic
1109421089 13:62113909-62113931 AACTCAGATTTTTTTGTGGTGGG - Intergenic
1110383292 13:74878808-74878830 AAGTCAGTTGTGGTTGGGGAAGG - Intergenic
1111691245 13:91565824-91565846 AATCCAGGTGTCTGTGGGGTTGG + Intronic
1112235136 13:97629187-97629209 AACTTATTTGTCATTCGGGTGGG - Intergenic
1112498511 13:99924419-99924441 AACTGGGTTTTGTTTGGGGTTGG + Intergenic
1114676633 14:24444898-24444920 AACTGAGATGTCTATGGTGTTGG - Intergenic
1115781868 14:36777708-36777730 AACTAAGATGTCTTCAGGGTTGG - Intronic
1115834371 14:37381561-37381583 AATTCAGTAGACTTTGGGTTGGG - Intronic
1117175476 14:53141898-53141920 AAACCTGTTGTATTTGGGGTTGG - Intronic
1117182761 14:53208958-53208980 AACTCAGCATTCTTTGGGTTTGG + Intergenic
1117207825 14:53462742-53462764 AAGTAAGTTGCATTTGGGGTTGG + Intergenic
1119928658 14:78522641-78522663 AACTCATTTGTAGTCGGGGTTGG + Intronic
1120639619 14:86994711-86994733 CACTCATTTGTCTTTATGGTAGG - Intergenic
1121392337 14:93586305-93586327 TATTCAGTTGTCTTTGGGTAGGG + Intronic
1122227351 14:100287415-100287437 AAGGCATTTGTCTCTGGGGTGGG - Intergenic
1124555641 15:30723163-30723185 AAATCAGTTGTCTTTTGTTTTGG + Intronic
1127653817 15:61036461-61036483 AAACCATTTGTATTTGGGGTGGG + Intronic
1128220847 15:65967544-65967566 GACTCAGTTGTCTATGGTGAGGG + Intronic
1128452903 15:67817259-67817281 AACTCAGGTTCCCTTGGGGTCGG + Intergenic
1128960623 15:72000113-72000135 AACCCATTTGTCTTTTGAGTGGG - Intronic
1129545788 15:76393529-76393551 AACTCATTTATCTTTAGGGTAGG + Intronic
1129887307 15:79047660-79047682 AACTCAGTTGCCTTGGAGCTGGG + Intronic
1130553297 15:84905509-84905531 AACTCAGCTTTCTGTTGGGTGGG + Intronic
1130907623 15:88251648-88251670 AACTCAGCTGGCTCTTGGGTGGG - Intronic
1131430233 15:92381740-92381762 AACTGAGATGTCTTTGGTGTTGG + Intergenic
1140202434 16:72905380-72905402 AACTCAGTTGTCCTCTGGCTGGG - Intronic
1143687463 17:8529522-8529544 AATTCAGTCCTCTTTGGCGTTGG - Intronic
1146820049 17:35977677-35977699 GACCCAGTCGTCATTGGGGTTGG + Exonic
1147031024 17:37636879-37636901 CACTCAGATGTCTGTGGTGTTGG - Intronic
1147042770 17:37731114-37731136 AGCTCAGTAGCCTTTGGGGACGG - Intronic
1149642971 17:58216733-58216755 CACTCTGTTGTCTTTGGAGGTGG - Exonic
1150616386 17:66775668-66775690 AACAAAGATGTCTTTGGGGGTGG - Intronic
1156592415 18:38506031-38506053 AACTGAGATGTCTATGGTGTTGG + Intergenic
1157665495 18:49483215-49483237 AACTCTGTTGTCTTTAGAATTGG - Intronic
1159685796 18:71418412-71418434 AACTCAGAGGCCTTAGGGGTGGG + Intergenic
1160343222 18:78107714-78107736 AAGTAAGTTCTCTTTGGGTTTGG + Intergenic
1161647973 19:5466087-5466109 AAATCCCTTGTCCTTGGGGTGGG - Intergenic
1162217159 19:9145883-9145905 AGTTCAATTCTCTTTGGGGTGGG - Intronic
1163147941 19:15394702-15394724 AATTCAGTAGTCTTTGGGCTGGG - Intronic
1166135973 19:40777497-40777519 GTCTCCGTGGTCTTTGGGGTGGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168679158 19:58301160-58301182 AAATGAGTTTTGTTTGGGGTAGG - Exonic
925441902 2:3895291-3895313 AGCTCAGATTTTTTTGGGGTGGG + Intergenic
930494950 2:52129366-52129388 AAATCATTCTTCTTTGGGGTGGG - Intergenic
930977829 2:57485838-57485860 AAATTAGTTGTCTTTGGAATGGG + Intergenic
932073141 2:68641088-68641110 AACTGAGGTGTCTGTGGTGTTGG - Intergenic
937501382 2:122482890-122482912 AAATCAATTGTCATTGGGCTTGG - Intergenic
939856367 2:147363653-147363675 TACACAGTTGAATTTGGGGTAGG + Intergenic
940901189 2:159128148-159128170 ATCTCACTTGTCTTTGGATTAGG + Intronic
941506459 2:166351676-166351698 AAGTCATTAGTCTTGGGGGTTGG + Intronic
943667908 2:190629716-190629738 AACTGAGATGTCTATGGTGTTGG - Intergenic
945662518 2:212704046-212704068 AACTCAGTTTTCTTTCTGGCTGG - Intergenic
945841662 2:214894366-214894388 AACTGAGATGTCTATGGTGTTGG + Intergenic
946188437 2:217994709-217994731 AACTCAGATTTCTTGGGGCTGGG - Intronic
1168770979 20:416581-416603 ATCTCTGTTTCCTTTGGGGTCGG + Intronic
1170359678 20:15531870-15531892 AAGTCTGTTGTCTTTGTGGTTGG + Intronic
1170548475 20:17455127-17455149 CACTGAGAGGTCTTTGGGGTAGG - Intronic
1173840502 20:46153649-46153671 ACCTTAGCTTTCTTTGGGGTAGG - Intergenic
1175266077 20:57704278-57704300 AACTCAGTTGTCTTTGGGGTGGG - Intronic
1175589356 20:60175583-60175605 AACTGAGATGTCTATGGTGTTGG + Intergenic
1176055428 20:63143438-63143460 AACTGAGATGTCTATGGTGTTGG + Intergenic
1176734710 21:10535212-10535234 AACTCAATTGGCTGTGGGCTGGG - Intronic
1177589800 21:23147876-23147898 AAATGAGGTATCTTTGGGGTGGG + Intergenic
1182984797 22:34706367-34706389 AAACCAGGTGTCTTTGGGGTGGG - Intergenic
1183971953 22:41484061-41484083 AAGTTTGTTGTCTTTGGGGCAGG + Intronic
949720917 3:6989005-6989027 AAATCAGTTTTCTTTAGGGTAGG + Intronic
949827341 3:8178622-8178644 AACTCAGTGATGCTTGGGGTTGG - Intergenic
949851965 3:8428860-8428882 CACTAAGTTATCTTTGAGGTGGG - Intergenic
957598360 3:82299310-82299332 AATTGAGATGTCTATGGGGTTGG - Intergenic
960514028 3:118583063-118583085 AATTTAATTGGCTTTGGGGTGGG - Intergenic
960646782 3:119893916-119893938 CACTCAGTTGTATAAGGGGTGGG - Intronic
961030207 3:123596217-123596239 ATGTCAGTTGTCTTCGTGGTTGG - Intergenic
961121080 3:124370825-124370847 AACTGAGATGTCTATGGTGTTGG + Intronic
962029176 3:131581337-131581359 AACTCTCCTGTCTTTGGGGCAGG + Intronic
962347353 3:134627950-134627972 AATTCAGTGGTCAGTGGGGTGGG - Intronic
962739284 3:138350970-138350992 AAGTCAGTTACCCTTGGGGTTGG + Intronic
964634888 3:158847830-158847852 CACTCAGTTGCCTTGGGTGTGGG - Intergenic
969292699 4:6251030-6251052 AAAGCTCTTGTCTTTGGGGTGGG - Intergenic
971418099 4:26452122-26452144 AACTCAGCTGTGTTTTGGGGTGG + Intergenic
971855414 4:32036742-32036764 CACTGAGTTGGCTTTGGAGTAGG - Intergenic
973700779 4:53534694-53534716 AACCTATTTGTCTTTGGGGGAGG + Intronic
974653894 4:64793083-64793105 AACTCATTTGGCTTTGGCCTTGG + Intergenic
975717753 4:77221361-77221383 AGCTCAGTTCTATTTCGGGTAGG - Intronic
975755245 4:77565335-77565357 ATCTGAGTTGTGTTTGGGGGAGG - Intronic
976235715 4:82894489-82894511 AACTGAGATGTCTATGGTGTTGG + Intronic
976336371 4:83892672-83892694 ATCTCAGTTCTGTTTGGGATTGG + Intergenic
976836268 4:89378018-89378040 AACTGAGGTGTCTATGGTGTTGG - Intergenic
978332472 4:107629428-107629450 AACTGAGATGTCTATGGTGTTGG - Intronic
980791542 4:137626840-137626862 AACTCAGATGTCTTTAGGAAAGG - Intergenic
981024006 4:140057679-140057701 AATTCAATTATCTTTGGGTTGGG + Intronic
981112315 4:140949676-140949698 AACTCATTTTTTTTTGGGGGGGG - Intronic
983530332 4:168803809-168803831 CACTCTGTTGTCTTTGGCATGGG + Intronic
986636285 5:9824994-9825016 AAGTCAGTTTTCTGTTGGGTTGG - Intergenic
987121295 5:14769985-14770007 TACTGATTTGTCTTCGGGGTGGG - Intronic
988901607 5:35738702-35738724 AATTGAGATGTCTGTGGGGTTGG + Intronic
989095323 5:37776400-37776422 ATCACAGATGGCTTTGGGGTTGG + Intergenic
995239665 5:109871582-109871604 AACTCCATTTTCTTTGGGTTGGG - Intergenic
998789896 5:145754892-145754914 AACTGAGATGTCTGTGGTGTTGG - Intronic
998872730 5:146568802-146568824 AACTCTGATGTTTCTGGGGTTGG + Intergenic
1001143661 5:169165718-169165740 AAAGCAATTGTCTTTGGGGGTGG - Intronic
1004631016 6:17421369-17421391 ATCTCAGTAGTTTTGGGGGTGGG - Intronic
1006982291 6:38156236-38156258 AAATTGGTTTTCTTTGGGGTAGG + Intergenic
1007698031 6:43746312-43746334 AATTCAGTGGTCTCTGGGGGAGG + Intergenic
1008744895 6:54657856-54657878 AACTCTTTTGTCTTAGGGATAGG - Intergenic
1009405820 6:63311323-63311345 AACTGAGATGTCTATGGTGTTGG + Intronic
1011954700 6:93012602-93012624 AACTCAGGCTTCTTTAGGGTTGG - Intergenic
1012526788 6:100187390-100187412 AACTCAGTTCTCAGTGGGGTAGG + Intergenic
1013485045 6:110588914-110588936 CACTCAGTTGGCTTCTGGGTGGG - Intergenic
1015927074 6:138321286-138321308 AATTAAATTGTCTTTGTGGTAGG + Intronic
1016337359 6:143021692-143021714 GACTCAGTGGTATTCGGGGTGGG - Intergenic
1016491852 6:144613788-144613810 TCCTCAGTTTTCTTTGGGGAGGG - Intronic
1016662445 6:146597337-146597359 AACTCACCTCTCTGTGGGGTTGG + Intergenic
1019515586 7:1438505-1438527 CACTCAGGTGTCTGTGGGGCTGG - Intronic
1020891319 7:13881219-13881241 ATTTCTGTTGTCTTTGGAGTTGG + Intergenic
1021667350 7:22997899-22997921 ATCTTATTTGTCCTTGGGGTAGG - Intronic
1024723789 7:52169344-52169366 ACCTAAGTTTTCTCTGGGGTTGG - Intergenic
1025260432 7:57414440-57414462 ATCTGAGTTGTGTTAGGGGTGGG + Intergenic
1026814623 7:73500949-73500971 AACTCTGTTGTTTTTGGTTTTGG - Intronic
1028340524 7:89714193-89714215 TATTCATTTGTTTTTGGGGTAGG - Intergenic
1028418019 7:90599992-90600014 AGCTCAGCTGTATTTGGGGTGGG - Intronic
1031030454 7:116728610-116728632 TACTCAGTTTGCTTTGTGGTTGG - Intronic
1031526197 7:122823542-122823564 AATTCAGTAGGCTTGGGGGTGGG + Intronic
1031567234 7:123315366-123315388 AATTGAGATGTCTTTGGTGTTGG + Intergenic
1032791769 7:135247674-135247696 ATCCCAGTGCTCTTTGGGGTGGG - Intronic
1034122669 7:148641650-148641672 AAATCAGTTGTCTGTGCTGTGGG - Intergenic
1035265772 7:157689753-157689775 AGCGCAGTTCTCTTTGGGGGAGG + Intronic
1035995696 8:4544187-4544209 AACTCAGATGGCTTTAGGTTTGG - Intronic
1037661573 8:20932121-20932143 AACTGAGGTGTCTATGGTGTTGG + Intergenic
1038525782 8:28271981-28272003 GTCTCAGTGGTCTTTTGGGTAGG - Intergenic
1038996721 8:32931451-32931473 ATCTCATTTCTCTTTCGGGTGGG + Intergenic
1040420400 8:47234523-47234545 AACTTAGATGACTTTGGGTTTGG + Intergenic
1042535765 8:69856699-69856721 AACTCAGTTTTCTTTGATATTGG + Intergenic
1045057140 8:98378948-98378970 AACCCTGTGGTGTTTGGGGTGGG + Intergenic
1045433941 8:102140549-102140571 AACAGAATTGTCTATGGGGTAGG - Intergenic
1045439772 8:102197864-102197886 AAATCAGTTGTCTTTGTGCCCGG - Intergenic
1046116159 8:109786386-109786408 AACAGAGTTGTCTTTCTGGTGGG + Intergenic
1046548101 8:115676766-115676788 AGCTCAGGTGTCTTTGGGAGGGG - Intronic
1047009516 8:120655926-120655948 ATCTCAGGTGTCATTGGTGTGGG + Intronic
1047543742 8:125796199-125796221 ACCTCAGGAGTCTTTGGGTTTGG + Intergenic
1048775289 8:137939124-137939146 GACTCAGGGTTCTTTGGGGTGGG + Intergenic
1049503696 8:142983263-142983285 ACTTCAGATGGCTTTGGGGTTGG - Intergenic
1051727305 9:20101587-20101609 AACTCAGACATCTCTGGGGTGGG + Intergenic
1053462498 9:38281411-38281433 CACCCAGTAGTCTTCGGGGTTGG + Intergenic
1056219780 9:84439733-84439755 CACACATTTGTATTTGGGGTGGG + Intergenic
1056811463 9:89768201-89768223 AATTGAGTTGTCTGTGGTGTTGG - Intergenic
1059388428 9:113983586-113983608 AACTCTGATTTGTTTGGGGTGGG + Intronic
1059686210 9:116639128-116639150 AACTAAGTTGATTTTGGAGTGGG + Intronic
1059688424 9:116660271-116660293 AAATCAGTTGTCCTAGGGTTTGG - Intronic
1061631474 9:131874824-131874846 AATTCAGGTGTCTTTGGGCTTGG - Intronic
1187650568 X:21399921-21399943 ACCTCAGTACTCTTTGAGGTAGG - Intronic
1188890944 X:35610663-35610685 GACTCAGTGATGTTTGGGGTTGG - Intergenic
1191961767 X:66711199-66711221 AAATCTGTTGTCTGTGGGATGGG - Intergenic
1192618126 X:72649237-72649259 CAATCACTTGACTTTGGGGTTGG - Intronic
1193116172 X:77777727-77777749 TGCTCAGTTGACTTTTGGGTGGG - Intronic
1193939974 X:87670486-87670508 AACTCAGGTGGCTTTTGTGTAGG - Intergenic
1194558287 X:95389256-95389278 AACACAGTGGACTTGGGGGTGGG - Intergenic
1195904754 X:109832754-109832776 AACTGAGATGTCTATGGTGTGGG + Intergenic
1197679008 X:129362525-129362547 ACCTCATTTGGCTTTGGTGTTGG - Intergenic
1202592748 Y:26504747-26504769 AACTCAATTGGCTGTGGGCTGGG - Intergenic