ID: 1175266339

View in Genome Browser
Species Human (GRCh38)
Location 20:57705777-57705799
Sequence GCCAGAAATGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 1, 2: 29, 3: 96, 4: 277}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175266339_1175266350 20 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266350 20:57705820-57705842 TGCTGGTATCTAGTGGGTGTGGG 0: 1
1: 0
2: 18
3: 187
4: 729
1175266339_1175266341 -10 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266341 20:57705790-57705812 CATTTCTGGCTGTCAAACCTGGG 0: 1
1: 0
2: 10
3: 86
4: 585
1175266339_1175266342 -5 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266342 20:57705795-57705817 CTGGCTGTCAAACCTGGGAGAGG 0: 1
1: 0
2: 2
3: 22
4: 264
1175266339_1175266352 26 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266352 20:57705826-57705848 TATCTAGTGGGTGTGGGAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 248
1175266339_1175266349 19 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266349 20:57705819-57705841 GTGCTGGTATCTAGTGGGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 175
1175266339_1175266343 -4 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266343 20:57705796-57705818 TGGCTGTCAAACCTGGGAGAGGG 0: 1
1: 0
2: 4
3: 32
4: 266
1175266339_1175266353 27 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266353 20:57705827-57705849 ATCTAGTGGGTGTGGGAGAGGGG 0: 1
1: 0
2: 1
3: 35
4: 340
1175266339_1175266348 14 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266348 20:57705814-57705836 GAGGGGTGCTGGTATCTAGTGGG 0: 1
1: 0
2: 4
3: 33
4: 273
1175266339_1175266347 13 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266347 20:57705813-57705835 AGAGGGGTGCTGGTATCTAGTGG 0: 1
1: 0
2: 1
3: 20
4: 174
1175266339_1175266351 25 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266351 20:57705825-57705847 GTATCTAGTGGGTGTGGGAGAGG 0: 1
1: 0
2: 2
3: 25
4: 244
1175266339_1175266344 -3 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266344 20:57705797-57705819 GGCTGTCAAACCTGGGAGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 243
1175266339_1175266345 3 Left 1175266339 20:57705777-57705799 CCATGTCTGGAGACATTTCTGGC 0: 1
1: 1
2: 29
3: 96
4: 277
Right 1175266345 20:57705803-57705825 CAAACCTGGGAGAGGGGTGCTGG 0: 1
1: 0
2: 3
3: 41
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175266339 Original CRISPR GCCAGAAATGTCTCCAGACA TGG (reversed) Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901985711 1:13073916-13073938 GCTTGGAAGGTCTCCAGACAAGG - Exonic
901996098 1:13152851-13152873 GCTTGGAAGGTCTCCAGACAAGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905460877 1:38122150-38122172 GCCATGAATGTGTCCAGACTAGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907239594 1:53074214-53074236 GCCAGGAATGGCTCCACACAGGG - Intronic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911181415 1:94863799-94863821 GCCAGAAATGTTTCAAGAGTTGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911853602 1:102850711-102850733 CCCAGAAATGCCAACAGACATGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
913333175 1:117684083-117684105 TCCAGAAATGCCTTCAAACAAGG - Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917891404 1:179441833-179441855 GCAAGAAATGTCTGCAGACCAGG - Intronic
918263493 1:182818417-182818439 GCCAGAACTGACTGCAGACTAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918867497 1:189921515-189921537 GGCAGAAATTCCCCCAGACAAGG + Intergenic
920707997 1:208268919-208268941 ACCAGCCTTGTCTCCAGACAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922791221 1:228312148-228312170 GCCAGAAAGAACTCCAGCCATGG + Intronic
923736509 1:236613916-236613938 TCCAGAAATGAGGCCAGACACGG - Intergenic
924255384 1:242177765-242177787 GCTAGCAAGGCCTCCAGACAGGG + Intronic
1064950783 10:20847688-20847710 GCCAGAAATGTTCTCAGAAAAGG + Intronic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069064068 10:63924088-63924110 TCCAGAAATATCCCCACACACGG - Intergenic
1069279926 10:66642595-66642617 GCTAGAAATATTTCCAAACAAGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070959892 10:80491324-80491346 GCCAGAGGGCTCTCCAGACAGGG - Intronic
1073484269 10:103806740-103806762 GCCTGAAATGGCTGGAGACAGGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074130113 10:110566797-110566819 GCCAGAATTGTCTCCAGCAGCGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076570554 10:131429930-131429952 CCCAGAATTGTCTCCGGACCTGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1076836825 10:133025392-133025414 GCCAGTGCTGTCCCCAGACAGGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078044904 11:7904739-7904761 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1080050900 11:27857945-27857967 GCCATAAATATCTCGAGTCAGGG + Intergenic
1081496139 11:43612535-43612557 GCCAGGAACTGCTCCAGACAAGG + Intronic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083379428 11:62253148-62253170 GCAAGAAATGTTTGCAGACCAGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088760986 11:112928640-112928662 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089328560 11:117674281-117674303 GCCAGGCCTGTCTCCAGACTGGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092025851 12:5239905-5239927 GCCAGAAATGTCTGGAGCAATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093788518 12:23219663-23219685 TCCAGAAATGTCTCCGGAATTGG - Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094475826 12:30839915-30839937 GTTAGACAAGTCTCCAGACAGGG + Intergenic
1097016298 12:55989724-55989746 GCCAGAAATGTCACTAGCTAAGG - Intronic
1098808707 12:75055549-75055571 GTTAGAAAGCTCTCCAGACAAGG + Intronic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1099561066 12:84174289-84174311 CCCAGCCATGTCTCCAGACCTGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101875937 12:108597115-108597137 GCCTGACATGTCCCCAGGCAGGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102308367 12:111824152-111824174 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105805443 13:23949473-23949495 GCCAGAAATGCCTTCAGAAATGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107581224 13:41788904-41788926 TCTAGAAATGTTTCCACACAGGG - Intronic
1108116780 13:47137402-47137424 GCCAGAAATGTCCAGACACATGG - Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109370463 13:61414797-61414819 GCAAGAAATGTATCCAGATAAGG - Intronic
1110238343 13:73239921-73239943 GCCAGAAACACATCCAGACACGG - Intergenic
1111177893 13:84621605-84621627 GCCAGAAATGTCTCAGGGAATGG - Intergenic
1111477964 13:88778722-88778744 GCTAGAAATGTGACCAAACAAGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1113437640 13:110306455-110306477 GCCACCAGGGTCTCCAGACAAGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115000150 14:28412136-28412158 GCGAGAAATGTGTGCAGACCAGG + Intergenic
1115785354 14:36819582-36819604 GCCTTAAAAGTCTCAAGACAAGG + Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120681355 14:87484691-87484713 GCCAGAGATGTCCCGAGAAATGG + Intergenic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122501919 14:102206513-102206535 TCCTGAAATTTCTCCACACATGG + Intronic
1124946052 15:34267551-34267573 GTCAGAGATGTCTCCAGGCTGGG + Intronic
1127072094 15:55297043-55297065 GCCACAAATGCATCCAGAGAGGG + Intronic
1129163111 15:73758579-73758601 GACAGAAATGTCCTCAGACATGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130678283 15:85973728-85973750 GCCAGAAATGTAGCCTAACATGG + Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131051537 15:89351444-89351466 GGCAGAGATGTCTGCAGAGAGGG + Intergenic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132949753 16:2554542-2554564 GCCAGAAGTGACCCCAGAAAGGG + Intronic
1132964595 16:2645625-2645647 GCCAGAAGTGACCCCAGAAAGGG - Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135552128 16:23406573-23406595 GCAAGAAAAGTCTCCATAGAAGG - Intronic
1136138765 16:28275514-28275536 CCCAGAAATGGCTCAAGACGTGG + Intergenic
1138331614 16:56220019-56220041 CCCAGAAATGTCAACAGAAAGGG + Intronic
1139363438 16:66418177-66418199 GTCAGAAAAGCCTCCAGAGAAGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141638220 16:85326854-85326876 GGAAGAAATGTTTCCAGGCAGGG - Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148525228 17:48326218-48326240 GCCAGAACTGTCTCCATAAATGG + Intronic
1149576266 17:57715691-57715713 CCCAGACAGGCCTCCAGACAGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1151783459 17:76263048-76263070 GCCAGAAATGTCTCTCCCCAGGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158916348 18:62135354-62135376 GCCAGACAGGTCTACAGGCAGGG + Intronic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160819538 19:1051614-1051636 GCCAGAAAAGGCTTCTGACAAGG + Intronic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162006182 19:7781159-7781181 GCAAGAAATGTGTACAGACCAGG + Intergenic
1162763009 19:12899574-12899596 GCCAGGCATCTCTCCAGAAAGGG - Exonic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164030311 19:21397491-21397513 GCCAGAGAGGACTCCAGGCAGGG - Intronic
1164290643 19:23866000-23866022 GCAAGAAATGTGTGCAGACCAGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165794636 19:38511818-38511840 GACAGACCTATCTCCAGACAAGG + Intronic
1166968772 19:46547965-46547987 GCCAGAAATTGCTGCAGGCAGGG + Intronic
1167808831 19:51810618-51810640 GCAAGAAATGTGTGCAGACCAGG - Intronic
1167826382 19:51977412-51977434 GCAAGAAATGTGTGCAGACCAGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1168679876 19:58307005-58307027 GCAAGAAATGTGTGCAGACCAGG + Intronic
927072983 2:19549037-19549059 GCCAGAAATCTCTGTAGCCACGG - Intergenic
929083514 2:38145704-38145726 GTCAGAAATTTCTACAGAGATGG + Intergenic
929283792 2:40113284-40113306 GCTAGGAATGTCTCCAGCCTGGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930909470 2:56613991-56614013 GCCAGAAATGCCTCCATTGATGG - Intergenic
932893391 2:75615242-75615264 GCAAGAAAGGTCCCCAGAAATGG - Intergenic
935309526 2:101769880-101769902 CCCAGAAATGTCTTGAGTCATGG + Intronic
935735135 2:106100492-106100514 GCCAGAACTGTCCAAAGACAGGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
938295437 2:130175610-130175632 GCCAGAAAAGACTCAGGACAAGG + Intronic
938461185 2:131498217-131498239 GCCAGAAAAGACTCAGGACAAGG - Intergenic
938810390 2:134847276-134847298 GCCAGAAACCTCATCAGACAGGG + Intronic
939200621 2:139030291-139030313 GCCACAAATGTCTACAGTCCAGG - Intergenic
939629277 2:144514917-144514939 GCCAGAGATGTCCGCAGTCATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940797406 2:158095096-158095118 GACAGAAATTGCTCCAGACAGGG + Intronic
941988683 2:171533520-171533542 GAGAGAAATGTCCCCAAACATGG - Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948110214 2:235448908-235448930 GTCAGAGATGTCTCCACAAAAGG + Intergenic
948901276 2:240957964-240957986 GCCAGCACTGGCTCCAGAGAAGG - Intronic
1168800022 20:638680-638702 GCCAGAATGGCCTCCAGAGAGGG + Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171024790 20:21620115-21620137 CCCAGAAATAAATCCAGACATGG + Intergenic
1171474965 20:25401473-25401495 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174196722 20:48777451-48777473 CCCAGAAGTGCCTACAGACAGGG + Intronic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175544586 20:59770150-59770172 GCCAGAAGTGTCCGCAGACTGGG - Intronic
1175641783 20:60636193-60636215 ACCTGAAATGTCACCATACATGG - Intergenic
1175777452 20:61662300-61662322 GCCAGCGATGGCTCCAGAAAGGG - Intronic
1178065830 21:28903454-28903476 GCCAGAAAAGTTTACAGACAAGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179231943 21:39511935-39511957 GCCAGAAAGGTGTGCAGACCAGG - Intronic
1181053214 22:20247355-20247377 GCCAGAAATAGCTCCAGGCGGGG + Intronic
1181114818 22:20625143-20625165 GCCAGAAAAGACTCAGGACAAGG + Intergenic
1181541502 22:23575398-23575420 GCCACAAGTGTCCCCAGTCAAGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181796879 22:25317904-25317926 GCCACAAGTGTCCCCAGTCAAGG - Intergenic
1181887344 22:26031780-26031802 GGCAGGAAGGTCTCCAGAGACGG - Intergenic
1181890317 22:26057023-26057045 GCCAGAAATGTGTCTCTACAGGG - Intergenic
1182900533 22:33894677-33894699 ACCAGATATGGGTCCAGACAAGG - Intronic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953462777 3:43094948-43094970 GCCAGATCTGACTGCAGACAGGG - Intronic
953627381 3:44581889-44581911 GACAGAACTGTCTCCCAACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955778902 3:62462859-62462881 GGCAGGAATATCTCCACACATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
956162753 3:66372318-66372340 GCCACCACTGTCTCCAGAAAAGG - Intronic
957665437 3:83218960-83218982 GCCAGCCATGGCTCCAGACCAGG - Intergenic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962331296 3:134481039-134481061 GCCATAAACTTCTCCAGAAATGG + Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963084988 3:141428118-141428140 GCCAGAGAGGTCTCCAAGCAGGG - Intronic
963237512 3:142970336-142970358 CCCAGTACTGTCTCCAGACAGGG - Intronic
963398434 3:144764076-144764098 GTCAGAAATGTGTCCTGAGACGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965819700 3:172672893-172672915 GACAGAACTGTCCCCAGATATGG + Intronic
965960370 3:174422324-174422346 TCCAGAAATGTCTACCAACAAGG - Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967791470 3:193553577-193553599 TCCACAAATGTCACCAGAAATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
969896645 4:10311606-10311628 GCCTGGCATGTCTCCACACACGG - Intergenic
972531489 4:39965163-39965185 GCCAGAAATTGGTCCAGAAATGG - Intronic
972783881 4:42309445-42309467 GCCAGAAATGTCTCCCAGCTGGG + Intergenic
975737816 4:77398755-77398777 GCAAGAAATGTGTGCAGACCAGG - Intronic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976180229 4:82391917-82391939 ACCAGAAAGCTCTCCAGTCATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978135015 4:105247020-105247042 GCCAGAAATGCCTTCTGCCATGG + Intronic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978627381 4:110702663-110702685 GTAAGAAATTTCTACAGACATGG - Intergenic
979550882 4:121989688-121989710 GGCAGAAATGACTTCAGGCAGGG - Intergenic
981432370 4:144676611-144676633 CCCAGAGATGGCTCCAGAGATGG - Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
982664994 4:158250941-158250963 GCCAGAATTTTCACCAGAGAGGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984802123 4:183725116-183725138 GCCAGAATTGACTGCAGAGAAGG + Intergenic
986668864 5:10126231-10126253 GTGAGAAATGACTCCAGACTGGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987371704 5:17199549-17199571 TCCAGACGTGTTTCCAGACAAGG + Intronic
987948857 5:24650809-24650831 GCAAGAAATGTGTGCAGACCAGG + Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989780173 5:45255306-45255328 TCCAGAAATGTCTTCACACTTGG + Intergenic
989998840 5:50868555-50868577 GCCAGAAATGAAAACAGACATGG - Intergenic
990364310 5:55054254-55054276 GACAGAAATGTTTCTAGCCAGGG + Intergenic
990526511 5:56633588-56633610 GCCAGACAGATCTCCAGAAATGG + Intergenic
990613449 5:57482791-57482813 TCCAGAAATGCTTTCAGACACGG + Exonic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994608265 5:101999261-101999283 GGCAGAAATGACTCCAGATCAGG + Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997633777 5:135389837-135389859 GTCACAAATGTCTCCTGAAAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999167362 5:149561541-149561563 GCCAGAGATATGTCCTGACAGGG + Intronic
1000846157 5:166282851-166282873 TGGAGAAATGTCTCTAGACATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006219704 6:32478146-32478168 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1006228983 6:32565906-32565928 GCAAGAAATGTGTGCAGACCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1012244100 6:96906914-96906936 TCCAGAGAAGTCTCCAGAGAAGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014505432 6:122248450-122248472 GCCAGCCATGGCTCCAGACCTGG - Intergenic
1017457175 6:154612066-154612088 CCCAGAAATGTCTACAAATAAGG + Intergenic
1017825153 6:158076279-158076301 GCCAGACATGGCACCAGGCATGG + Intronic
1019026170 6:168964779-168964801 TCCAGAAACGGCTCCTGACAAGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021550416 7:21865650-21865672 GGTAGAAATGTTTCCAGAAAGGG + Intronic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023101286 7:36721159-36721181 GCCAGAACTGTCTCCACCAACGG + Intronic
1024251138 7:47506525-47506547 GGCAGAAAAGTCTCCAGGCCAGG + Intronic
1026969721 7:74460664-74460686 GCCAGAAATCCCTGAAGACAAGG - Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1029168132 7:98610486-98610508 TCCAGATCTGTCTCCAGATATGG + Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030749072 7:113207309-113207331 CCCTGAACTGTGTCCAGACAAGG + Intergenic
1031361385 7:120852938-120852960 GCCAGGAATGTCTCCAGCACAGG + Intronic
1031946062 7:127841777-127841799 GTGAGAAATGTGTTCAGACAGGG - Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032425587 7:131819943-131819965 TCCAGAAATGGCCCCAGAGAGGG - Intergenic
1033453950 7:141485738-141485760 GCCAGTGATGCCACCAGACATGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038489523 8:27959853-27959875 GCCAGCAATGGCTCCACCCATGG - Intronic
1038620410 8:29137429-29137451 CCCAGGAATGTCTGCAGGCACGG + Intronic
1039068361 8:33628803-33628825 GCCAGAAATGAGGCTAGACAGGG - Intergenic
1040023872 8:42764045-42764067 GTCTGAAGTGTCTCCAGAGAGGG - Intronic
1041853633 8:62422650-62422672 GTCAGAAATTTTTCAAGACAGGG + Intronic
1041985669 8:63920156-63920178 GACAGAAATGTGTCCAGGCCAGG + Intergenic
1042950158 8:74192819-74192841 GCCTGGAATGTTTCCAGATAAGG - Intergenic
1043037024 8:75211105-75211127 GGCAGAAAAGTTTCCAGAGAGGG - Intergenic
1044410555 8:91877634-91877656 CCCAGAAATCTCTTCAGGCATGG - Intergenic
1045219241 8:100181168-100181190 GCAATAAAAGTCTCAAGACATGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047566135 8:126046501-126046523 CCCAGAAGTGTCTCTAGGCATGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050737270 9:8778460-8778482 GCTAGTAATCTGTCCAGACACGG - Intronic
1052566102 9:30154002-30154024 GAGAGAAATGTGTCCAAACAAGG + Intergenic
1053297334 9:36924295-36924317 GTCAGAATGGTCTCCAGAGAAGG + Intronic
1053427073 9:38017197-38017219 GCCAGAAATGTGACCAAAAAGGG - Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1057905925 9:98983421-98983443 GCCAGAAATCACACCAGCCATGG + Intronic
1058101291 9:100920196-100920218 CCCAGAAATCTCTCCTAACATGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061220049 9:129245247-129245269 TCCAGAAATGTCTCCAGCTGCGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061903350 9:133684178-133684200 GCCACAAGTGTGTTCAGACATGG - Intronic
1062116098 9:134809809-134809831 GTCAGAAATGTCCCCAGAGAGGG - Intronic
1062701091 9:137903882-137903904 GCCAGCAGTGACACCAGACAGGG - Intronic
1185765994 X:2726308-2726330 GCTAGAGATGGCTCCAGCCACGG - Exonic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188950086 X:36360366-36360388 GCCAGATGTGTCCCCAGTCATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1192769942 X:74178423-74178445 GCAAGAAATGTGTGCAGACCAGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197529040 X:127600206-127600228 GTTAGAATTGTCGCCAGACACGG + Intergenic
1197729823 X:129800048-129800070 GCCAGAAAGCTCTCTAGACTGGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1202075093 Y:21029516-21029538 GCAAGAAATGTGTGCAGACAAGG - Intergenic