ID: 1175269054

View in Genome Browser
Species Human (GRCh38)
Location 20:57720978-57721000
Sequence GTTACTGAAGGGCCGTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175269054_1175269059 1 Left 1175269054 20:57720978-57721000 CCATAGAACGGCCCTTCAGTAAC No data
Right 1175269059 20:57721002-57721024 AAGGGCCATGCTAAACATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175269054 Original CRISPR GTTACTGAAGGGCCGTTCTA TGG (reversed) Intergenic
No off target data available for this crispr