ID: 1175274243

View in Genome Browser
Species Human (GRCh38)
Location 20:57756713-57756735
Sequence CCCCTGCCACTGCTGTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175274243_1175274251 26 Left 1175274243 20:57756713-57756735 CCCAGTTACAGCAGTGGCAGGGG No data
Right 1175274251 20:57756762-57756784 TTCTATTGAGAAAGAAGAAAGGG No data
1175274243_1175274248 3 Left 1175274243 20:57756713-57756735 CCCAGTTACAGCAGTGGCAGGGG No data
Right 1175274248 20:57756739-57756761 TAGGCACCAAAACAAAATTAAGG No data
1175274243_1175274250 25 Left 1175274243 20:57756713-57756735 CCCAGTTACAGCAGTGGCAGGGG No data
Right 1175274250 20:57756761-57756783 GTTCTATTGAGAAAGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175274243 Original CRISPR CCCCTGCCACTGCTGTAACT GGG (reversed) Intergenic
No off target data available for this crispr