ID: 1175275030

View in Genome Browser
Species Human (GRCh38)
Location 20:57762541-57762563
Sequence ATATGGACCCTGCTATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175275026_1175275030 -5 Left 1175275026 20:57762523-57762545 CCACTCAAAGCATCCAATATATG No data
Right 1175275030 20:57762541-57762563 ATATGGACCCTGCTATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175275030 Original CRISPR ATATGGACCCTGCTATTTGG AGG Intergenic
No off target data available for this crispr