ID: 1175276675

View in Genome Browser
Species Human (GRCh38)
Location 20:57775309-57775331
Sequence GGAAGGTCTCGCCTTTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175276675_1175276680 10 Left 1175276675 20:57775309-57775331 CCTCACCAAAGGCGAGACCTTCC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175276675 Original CRISPR GGAAGGTCTCGCCTTTGGTG AGG (reversed) Intergenic
No off target data available for this crispr