ID: 1175276675 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:57775309-57775331 |
Sequence | GGAAGGTCTCGCCTTTGGTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175276675_1175276680 | 10 | Left | 1175276675 | 20:57775309-57775331 | CCTCACCAAAGGCGAGACCTTCC | No data | ||
Right | 1175276680 | 20:57775342-57775364 | CTGCCCCTGAGCCAGACAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175276675 | Original CRISPR | GGAAGGTCTCGCCTTTGGTG AGG (reversed) | Intergenic | ||