ID: 1175276680

View in Genome Browser
Species Human (GRCh38)
Location 20:57775342-57775364
Sequence CTGCCCCTGAGCCAGACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175276671_1175276680 14 Left 1175276671 20:57775305-57775327 CCCCCCTCACCAAAGGCGAGACC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276676_1175276680 5 Left 1175276676 20:57775314-57775336 CCAAAGGCGAGACCTTCCTCAGC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276668_1175276680 21 Left 1175276668 20:57775298-57775320 CCCTGGGCCCCCCTCACCAAAGG No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276667_1175276680 22 Left 1175276667 20:57775297-57775319 CCCCTGGGCCCCCCTCACCAAAG No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276675_1175276680 10 Left 1175276675 20:57775309-57775331 CCTCACCAAAGGCGAGACCTTCC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276674_1175276680 11 Left 1175276674 20:57775308-57775330 CCCTCACCAAAGGCGAGACCTTC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276672_1175276680 13 Left 1175276672 20:57775306-57775328 CCCCCTCACCAAAGGCGAGACCT No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276673_1175276680 12 Left 1175276673 20:57775307-57775329 CCCCTCACCAAAGGCGAGACCTT No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276677_1175276680 -7 Left 1175276677 20:57775326-57775348 CCTTCCTCAGCGAAGCCTGCCCC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data
1175276670_1175276680 20 Left 1175276670 20:57775299-57775321 CCTGGGCCCCCCTCACCAAAGGC No data
Right 1175276680 20:57775342-57775364 CTGCCCCTGAGCCAGACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175276680 Original CRISPR CTGCCCCTGAGCCAGACAAG TGG Intergenic
No off target data available for this crispr