ID: 1175278342

View in Genome Browser
Species Human (GRCh38)
Location 20:57787128-57787150
Sequence GTCTGAGGTGGGTGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175278342_1175278352 28 Left 1175278342 20:57787128-57787150 CCTGGACTTCACCCACCTCAGAC No data
Right 1175278352 20:57787179-57787201 GTGCCTCTTCAGGAGGATGAAGG No data
1175278342_1175278347 -5 Left 1175278342 20:57787128-57787150 CCTGGACTTCACCCACCTCAGAC No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data
1175278342_1175278350 18 Left 1175278342 20:57787128-57787150 CCTGGACTTCACCCACCTCAGAC No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278342_1175278351 21 Left 1175278342 20:57787128-57787150 CCTGGACTTCACCCACCTCAGAC No data
Right 1175278351 20:57787172-57787194 CAGAATCGTGCCTCTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175278342 Original CRISPR GTCTGAGGTGGGTGAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr