ID: 1175278344

View in Genome Browser
Species Human (GRCh38)
Location 20:57787140-57787162
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175278344_1175278350 6 Left 1175278344 20:57787140-57787162 CCACCTCAGACTGCCTTTCCTGG No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278344_1175278354 29 Left 1175278344 20:57787140-57787162 CCACCTCAGACTGCCTTTCCTGG No data
Right 1175278354 20:57787192-57787214 AGGATGAAGGAACTCAGCCGAGG No data
1175278344_1175278352 16 Left 1175278344 20:57787140-57787162 CCACCTCAGACTGCCTTTCCTGG No data
Right 1175278352 20:57787179-57787201 GTGCCTCTTCAGGAGGATGAAGG No data
1175278344_1175278351 9 Left 1175278344 20:57787140-57787162 CCACCTCAGACTGCCTTTCCTGG No data
Right 1175278351 20:57787172-57787194 CAGAATCGTGCCTCTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175278344 Original CRISPR CCAGGAAAGGCAGTCTGAGG TGG (reversed) Intergenic
No off target data available for this crispr