ID: 1175278347

View in Genome Browser
Species Human (GRCh38)
Location 20:57787146-57787168
Sequence CAGACTGCCTTTCCTGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175278337_1175278347 19 Left 1175278337 20:57787104-57787126 CCTCTTCCTGGCCCAGAGCTTCA No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data
1175278340_1175278347 8 Left 1175278340 20:57787115-57787137 CCCAGAGCTTCAGCCTGGACTTC No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data
1175278342_1175278347 -5 Left 1175278342 20:57787128-57787150 CCTGGACTTCACCCACCTCAGAC No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data
1175278336_1175278347 24 Left 1175278336 20:57787099-57787121 CCACACCTCTTCCTGGCCCAGAG No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data
1175278338_1175278347 13 Left 1175278338 20:57787110-57787132 CCTGGCCCAGAGCTTCAGCCTGG No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data
1175278341_1175278347 7 Left 1175278341 20:57787116-57787138 CCAGAGCTTCAGCCTGGACTTCA No data
Right 1175278347 20:57787146-57787168 CAGACTGCCTTTCCTGGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175278347 Original CRISPR CAGACTGCCTTTCCTGGCTG CGG Intergenic
No off target data available for this crispr