ID: 1175278350

View in Genome Browser
Species Human (GRCh38)
Location 20:57787169-57787191
Sequence AGTCAGAATCGTGCCTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175278344_1175278350 6 Left 1175278344 20:57787140-57787162 CCACCTCAGACTGCCTTTCCTGG No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278342_1175278350 18 Left 1175278342 20:57787128-57787150 CCTGGACTTCACCCACCTCAGAC No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278346_1175278350 3 Left 1175278346 20:57787143-57787165 CCTCAGACTGCCTTTCCTGGCTG No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278341_1175278350 30 Left 1175278341 20:57787116-57787138 CCAGAGCTTCAGCCTGGACTTCA No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278348_1175278350 -7 Left 1175278348 20:57787153-57787175 CCTTTCCTGGCTGCGGAGTCAGA No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data
1175278343_1175278350 7 Left 1175278343 20:57787139-57787161 CCCACCTCAGACTGCCTTTCCTG No data
Right 1175278350 20:57787169-57787191 AGTCAGAATCGTGCCTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175278350 Original CRISPR AGTCAGAATCGTGCCTCTTC AGG Intergenic
No off target data available for this crispr