ID: 1175283485

View in Genome Browser
Species Human (GRCh38)
Location 20:57820971-57820993
Sequence CTGTAGGGATGGATTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175283472_1175283485 20 Left 1175283472 20:57820928-57820950 CCATTCGCTGTTAAGAAGATCCC No data
Right 1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG No data
1175283479_1175283485 0 Left 1175283479 20:57820948-57820970 CCCTAGTGTGGGAGGGAGTGGGT No data
Right 1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG No data
1175283480_1175283485 -1 Left 1175283480 20:57820949-57820971 CCTAGTGTGGGAGGGAGTGGGTC No data
Right 1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175283485 Original CRISPR CTGTAGGGATGGATTGCAGA GGG Intergenic
No off target data available for this crispr