ID: 1175284476

View in Genome Browser
Species Human (GRCh38)
Location 20:57828819-57828841
Sequence GCCCACTACCCAGCCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175284476_1175284479 2 Left 1175284476 20:57828819-57828841 CCTGTTTGGGCTGGGTAGTGGGC No data
Right 1175284479 20:57828844-57828866 GGTTATGTTACTCAGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175284476 Original CRISPR GCCCACTACCCAGCCCAAAC AGG (reversed) Intergenic
No off target data available for this crispr