ID: 1175285239

View in Genome Browser
Species Human (GRCh38)
Location 20:57833387-57833409
Sequence TTCCTAAGGAGGCCTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175285232_1175285239 8 Left 1175285232 20:57833356-57833378 CCCGAGCTTCCTAAGGAGGCCTG No data
Right 1175285239 20:57833387-57833409 TTCCTAAGGAGGCCTGTTTCTGG No data
1175285233_1175285239 7 Left 1175285233 20:57833357-57833379 CCGAGCTTCCTAAGGAGGCCTGT No data
Right 1175285239 20:57833387-57833409 TTCCTAAGGAGGCCTGTTTCTGG No data
1175285234_1175285239 -1 Left 1175285234 20:57833365-57833387 CCTAAGGAGGCCTGTCCTTCTGT No data
Right 1175285239 20:57833387-57833409 TTCCTAAGGAGGCCTGTTTCTGG No data
1175285231_1175285239 9 Left 1175285231 20:57833355-57833377 CCCCGAGCTTCCTAAGGAGGCCT No data
Right 1175285239 20:57833387-57833409 TTCCTAAGGAGGCCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175285239 Original CRISPR TTCCTAAGGAGGCCTGTTTC TGG Intergenic
No off target data available for this crispr