ID: 1175286477

View in Genome Browser
Species Human (GRCh38)
Location 20:57840187-57840209
Sequence GTAGCTGGTGCCTCCGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175286477_1175286483 4 Left 1175286477 20:57840187-57840209 CCGCCTCCGGAGGCACCAGCTAC No data
Right 1175286483 20:57840214-57840236 TCTGCTTGTGCATAGCTGGCGGG No data
1175286477_1175286481 0 Left 1175286477 20:57840187-57840209 CCGCCTCCGGAGGCACCAGCTAC No data
Right 1175286481 20:57840210-57840232 AGTGTCTGCTTGTGCATAGCTGG No data
1175286477_1175286482 3 Left 1175286477 20:57840187-57840209 CCGCCTCCGGAGGCACCAGCTAC No data
Right 1175286482 20:57840213-57840235 GTCTGCTTGTGCATAGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175286477 Original CRISPR GTAGCTGGTGCCTCCGGAGG CGG (reversed) Intergenic
No off target data available for this crispr