ID: 1175288908

View in Genome Browser
Species Human (GRCh38)
Location 20:57860172-57860194
Sequence GGTGCCCAGGCACCCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175288908_1175288912 13 Left 1175288908 20:57860172-57860194 CCAATATGGGGTGCCTGGGCACC No data
Right 1175288912 20:57860208-57860230 CATAGACCCTCAACCCCTAAAGG No data
1175288908_1175288913 14 Left 1175288908 20:57860172-57860194 CCAATATGGGGTGCCTGGGCACC No data
Right 1175288913 20:57860209-57860231 ATAGACCCTCAACCCCTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175288908 Original CRISPR GGTGCCCAGGCACCCCATAT TGG (reversed) Intergenic
No off target data available for this crispr