ID: 1175291720

View in Genome Browser
Species Human (GRCh38)
Location 20:57880485-57880507
Sequence GGGAACTGCACCGGGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175291720_1175291726 -1 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291726 20:57880507-57880529 CAATTGCTTCTTTTGTCTGTGGG No data
1175291720_1175291731 25 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291731 20:57880533-57880555 GCAAGGCGGCCATCCCTGCTTGG No data
1175291720_1175291725 -2 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291725 20:57880506-57880528 CCAATTGCTTCTTTTGTCTGTGG No data
1175291720_1175291728 1 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291728 20:57880509-57880531 ATTGCTTCTTTTGTCTGTGGGGG No data
1175291720_1175291729 8 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291729 20:57880516-57880538 CTTTTGTCTGTGGGGGTGCAAGG No data
1175291720_1175291727 0 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291727 20:57880508-57880530 AATTGCTTCTTTTGTCTGTGGGG No data
1175291720_1175291732 26 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291732 20:57880534-57880556 CAAGGCGGCCATCCCTGCTTGGG No data
1175291720_1175291730 11 Left 1175291720 20:57880485-57880507 CCTGGGTTCCCGGTGCAGTTCCC No data
Right 1175291730 20:57880519-57880541 TTGTCTGTGGGGGTGCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175291720 Original CRISPR GGGAACTGCACCGGGAACCC AGG (reversed) Intergenic
No off target data available for this crispr