ID: 1175293535

View in Genome Browser
Species Human (GRCh38)
Location 20:57893961-57893983
Sequence GTAAAAGCCCCACCACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175293535_1175293538 12 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293538 20:57893996-57894018 CCTTTCCATTCTGAGGCTGAAGG No data
1175293535_1175293536 5 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293536 20:57893989-57894011 TTTATTTCCTTTCCATTCTGAGG No data
1175293535_1175293541 15 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293541 20:57893999-57894021 TTCCATTCTGAGGCTGAAGGGGG No data
1175293535_1175293543 29 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293543 20:57894013-57894035 TGAAGGGGGTTTTTAAATCCAGG No data
1175293535_1175293540 14 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293540 20:57893998-57894020 TTTCCATTCTGAGGCTGAAGGGG No data
1175293535_1175293539 13 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293539 20:57893997-57894019 CTTTCCATTCTGAGGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175293535 Original CRISPR GTAAAAGCCCCACCACACTG AGG (reversed) Intergenic
No off target data available for this crispr