ID: 1175293539

View in Genome Browser
Species Human (GRCh38)
Location 20:57893997-57894019
Sequence CTTTCCATTCTGAGGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175293533_1175293539 20 Left 1175293533 20:57893954-57893976 CCATGAGCCTCAGTGTGGTGGGG No data
Right 1175293539 20:57893997-57894019 CTTTCCATTCTGAGGCTGAAGGG No data
1175293535_1175293539 13 Left 1175293535 20:57893961-57893983 CCTCAGTGTGGTGGGGCTTTTAC No data
Right 1175293539 20:57893997-57894019 CTTTCCATTCTGAGGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175293539 Original CRISPR CTTTCCATTCTGAGGCTGAA GGG Intergenic
No off target data available for this crispr