ID: 1175303749

View in Genome Browser
Species Human (GRCh38)
Location 20:57961474-57961496
Sequence TTGGAGATCAGCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175303749_1175303760 26 Left 1175303749 20:57961474-57961496 CCCTCCTCCCTGCTGATCTCCAA No data
Right 1175303760 20:57961523-57961545 GACGCAGCCCCTGAATCGGAAGG No data
1175303749_1175303759 22 Left 1175303749 20:57961474-57961496 CCCTCCTCCCTGCTGATCTCCAA No data
Right 1175303759 20:57961519-57961541 CAAAGACGCAGCCCCTGAATCGG No data
1175303749_1175303754 -8 Left 1175303749 20:57961474-57961496 CCCTCCTCCCTGCTGATCTCCAA No data
Right 1175303754 20:57961489-57961511 ATCTCCAAAGCTGACCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175303749 Original CRISPR TTGGAGATCAGCAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr