ID: 1175313302

View in Genome Browser
Species Human (GRCh38)
Location 20:58026622-58026644
Sequence GCAGAAATGTGGGCCCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175313293_1175313302 22 Left 1175313293 20:58026577-58026599 CCCAGAGAAGACATCCTTCATCC No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data
1175313295_1175313302 8 Left 1175313295 20:58026591-58026613 CCTTCATCCAGCTCTAGCCACTT No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data
1175313292_1175313302 23 Left 1175313292 20:58026576-58026598 CCCCAGAGAAGACATCCTTCATC No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data
1175313296_1175313302 1 Left 1175313296 20:58026598-58026620 CCAGCTCTAGCCACTTGTTTCTG No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data
1175313291_1175313302 24 Left 1175313291 20:58026575-58026597 CCCCCAGAGAAGACATCCTTCAT No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data
1175313299_1175313302 -9 Left 1175313299 20:58026608-58026630 CCACTTGTTTCTGGGCAGAAATG No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data
1175313294_1175313302 21 Left 1175313294 20:58026578-58026600 CCAGAGAAGACATCCTTCATCCA No data
Right 1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175313302 Original CRISPR GCAGAAATGTGGGCCCAGTG AGG Intergenic
No off target data available for this crispr