ID: 1175317163

View in Genome Browser
Species Human (GRCh38)
Location 20:58056750-58056772
Sequence CACTTGAACCTGAGAGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175317163_1175317168 19 Left 1175317163 20:58056750-58056772 CCTTCGCCTCTCAGGTTCAAGTG No data
Right 1175317168 20:58056792-58056814 CAGACATGCGCCACCATGCCTGG No data
1175317163_1175317166 -8 Left 1175317163 20:58056750-58056772 CCTTCGCCTCTCAGGTTCAAGTG No data
Right 1175317166 20:58056765-58056787 TTCAAGTGATCCGAGTAGCTGGG No data
1175317163_1175317165 -9 Left 1175317163 20:58056750-58056772 CCTTCGCCTCTCAGGTTCAAGTG No data
Right 1175317165 20:58056764-58056786 GTTCAAGTGATCCGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175317163 Original CRISPR CACTTGAACCTGAGAGGCGA AGG (reversed) Intergenic