ID: 1175317165

View in Genome Browser
Species Human (GRCh38)
Location 20:58056764-58056786
Sequence GTTCAAGTGATCCGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175317163_1175317165 -9 Left 1175317163 20:58056750-58056772 CCTTCGCCTCTCAGGTTCAAGTG No data
Right 1175317165 20:58056764-58056786 GTTCAAGTGATCCGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175317165 Original CRISPR GTTCAAGTGATCCGAGTAGC TGG Intergenic