ID: 1175317411

View in Genome Browser
Species Human (GRCh38)
Location 20:58058664-58058686
Sequence TGCACAGCAGGCTACCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175317402_1175317411 14 Left 1175317402 20:58058627-58058649 CCAACCCACCTTGGTCTGGACCA No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317398_1175317411 24 Left 1175317398 20:58058617-58058639 CCGTCATCCTCCAACCCACCTTG No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317401_1175317411 17 Left 1175317401 20:58058624-58058646 CCTCCAACCCACCTTGGTCTGGA No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317397_1175317411 27 Left 1175317397 20:58058614-58058636 CCTCCGTCATCCTCCAACCCACC No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317404_1175317411 9 Left 1175317404 20:58058632-58058654 CCACCTTGGTCTGGACCAGCTGG No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317406_1175317411 6 Left 1175317406 20:58058635-58058657 CCTTGGTCTGGACCAGCTGGTCT No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317403_1175317411 10 Left 1175317403 20:58058631-58058653 CCCACCTTGGTCTGGACCAGCTG No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data
1175317407_1175317411 -6 Left 1175317407 20:58058647-58058669 CCAGCTGGTCTCAGCCATGCACA No data
Right 1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175317411 Original CRISPR TGCACAGCAGGCTACCAGGA TGG Intergenic