ID: 1175320852

View in Genome Browser
Species Human (GRCh38)
Location 20:58087217-58087239
Sequence GACCAAGATCTACCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175320848_1175320852 -10 Left 1175320848 20:58087204-58087226 CCTGGCCCATCCAGACCAAGATC No data
Right 1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG No data
1175320846_1175320852 -2 Left 1175320846 20:58087196-58087218 CCAATGGCCCTGGCCCATCCAGA No data
Right 1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG No data
1175320847_1175320852 -9 Left 1175320847 20:58087203-58087225 CCCTGGCCCATCCAGACCAAGAT No data
Right 1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175320852 Original CRISPR GACCAAGATCTACCTCCTCC AGG Intergenic
No off target data available for this crispr