ID: 1175323597

View in Genome Browser
Species Human (GRCh38)
Location 20:58107232-58107254
Sequence CCAACGGATGGTCCCATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175323590_1175323597 18 Left 1175323590 20:58107191-58107213 CCACAGAGAGAGGAGGATCACGG No data
Right 1175323597 20:58107232-58107254 CCAACGGATGGTCCCATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175323597 Original CRISPR CCAACGGATGGTCCCATATG AGG Intergenic
No off target data available for this crispr