ID: 1175333292

View in Genome Browser
Species Human (GRCh38)
Location 20:58179140-58179162
Sequence TCATTGCCACAAACAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175333287_1175333292 -3 Left 1175333287 20:58179120-58179142 CCGTATTTCTCCCTCACTCTTCA No data
Right 1175333292 20:58179140-58179162 TCATTGCCACAAACAGGACAGGG No data
1175333285_1175333292 24 Left 1175333285 20:58179093-58179115 CCATTCACAAAATGCTTCCTCTT No data
Right 1175333292 20:58179140-58179162 TCATTGCCACAAACAGGACAGGG No data
1175333286_1175333292 7 Left 1175333286 20:58179110-58179132 CCTCTTCTCTCCGTATTTCTCCC No data
Right 1175333292 20:58179140-58179162 TCATTGCCACAAACAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175333292 Original CRISPR TCATTGCCACAAACAGGACA GGG Intergenic
No off target data available for this crispr